C_189140579_10

• SNP ID: rs6387
• Gene: CYP11B1
• Gene Name: cytochrome P450 family 11 subfamily B member 1
• Set Membership: -
• Chromosome Location: Chr.8: 142877011 - 142877011 on Build GRCh38
• Polymorphism: C/T, Transition substitution
• Context Sequence [VIC/FAM]:

  GGGTCTCTGAGGCTGGATCTTCCCA[C/T]GTGGCCCACACCTTCTATGGTGTAG

Assay Details

Species:	Human
dbSNP Submissions:	NA
Phenotype:	MIM: 610613
Literature Links:	CYP11B1 PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global G (0.44) (0.56)	Caucasian - Not Available	CEPH (CEU) - Not Available
EAS G (0.24) (0.76)	African American - Not Available	YRI (Yoruba) - Not Available
SAS G (0.37) (0.63)	Chinese - Not Available	CHB (Han Chinese) - Not Available
AFR A (0.34) (0.66)	Japanese - Not Available	JPT (Japanese) - Not Available
EUR G (0.45) (0.55)
AMR G (0.38) (0.62)

CYP11B1 - cytochrome P450 family 11 subfamily B member 1
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_000497.3		Intron			NP_000488.3
NM_001026213.1		Intron			NP_001021384.1
XM_011516874.2		Intron			XP_011515176.1
XM_011516875.1		Intron			XP_011515177.1
XM_017013146.1		Intron			XP_016868635.1

More Information

Gene Ontology Categories:

Process(es)

C21-steroid hormone biosynthetic process
glucocorticoid biosynthetic process
immune response
cholesterol metabolic process
regulation of blood pressure
sterol metabolic process
aldosterone biosynthetic process
cellular response to hormone stimulus
cortisol biosynthetic process
cellular response to potassium ion
glucose homeostasis
secondary metabolite biosynthetic process
oxidation-reduction process
cellular response to peptide hormone stimulus

Function(s)

steroid 11-beta-monooxygenase activity
iron ion binding
oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen
heme binding
corticosterone 18-monooxygenase activity