GE Healthcare GST Vector Primers for Sequencing

Forward and reverse sequencing primers flanking the multiple cloning site of all pGEX vectors in the GST fusion system, for verification of inserted DNA sequence

Manufacturer: GE Healthcare 27141001

 View more versions of this product

Catalog No. 45-500-118

  Check Availability
Add to Cart

    Specifications

    For Use With (Equipment) Glutathione S-transferase (GST) gene fusion system
    For Use With (Application) Ready-to-use in sequencing double-stranded DNA inserted into pGEX Vectors
    Primer pGEX 5′ sequencing primer
    Quantity 260U
    Storage Requirements -20°C

    • Provided ready for immediate use
    • pGEX 5’ Sequencing Primer: 5’-d[GGGCTGGCAAGCCACGTTTGGTG]-3’
    • pGEX 3' Sequencing Primer: 5’-d[CCGGGAGCTGCATGTGTCAGAGG]-3’

  • Description & Specifications

Related Products


Product Content Feedback

We continue to work to improve your shopping experience and your feedback regarding this content is very important to us. Please use the form below to provide feedback related to the content on this product.

Product Title

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.

Cancel Submit