Promotional price valid on web orders only. Your contract pricing may differ. Interested in signing up for a dedicated account number?
Learn More

GE Healthcare GST Vector Primers for Sequencing

Forward and reverse sequencing primers flanking the multiple cloning site of all pGEX vectors in the GST fusion system, for verification of inserted DNA sequence

Manufacturer:  GE Healthcare 27141001

 View more versions of this product

Catalog No. 45-500-118


  Check Availability
Add to cart

Specifications

Description

  • Provided ready for immediate use
  • pGEX 5’ Sequencing Primer: 5’-d[GGGCTGGCAAGCCACGTTTGGTG]-3’
  • pGEX 3' Sequencing Primer: 5’-d[CCGGGAGCTGCATGTGTCAGAGG]-3’

Description & Specifications

Specifications

Glutathione S-transferase (GST) gene fusion system
pGEX 5′ sequencing primer
-20°C
Ready-to-use in sequencing double-stranded DNA inserted into pGEX Vectors
260U
Provide Content Correction

We continue to work to improve your shopping experience and your feedback regarding this content is very important to us. Please use the form below to provide feedback related to the content on this product.

Product Title

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.

Cancel Submit