Promotional price valid on web orders only. Your contract pricing may differ. Interested in signing up for a dedicated account number?
Learn More

GE Healthcare GST Vector Primers for Sequencing Available on GSA/VA Contract for Federal Government customers only.

Forward and reverse sequencing primers flanking the multiple cloning site of all pGEX vectors in the GST fusion system, for verification of inserted DNA sequence

Manufacturer:  GE Healthcare 27141001

 View more versions of this product

Catalog No. 45-500-118

Add to cart



  • Provided ready for immediate use
  • pGEX 5’ Sequencing Primer: 5’-d[GGGCTGGCAAGCCACGTTTGGTG]-3’
  • pGEX 3' Sequencing Primer: 5’-d[CCGGGAGCTGCATGTGTCAGAGG]-3’

This product(s) resides on a Fisher Scientific GSA or VA contract. If you are viewing this page as a nonregistered user, the price(s) displayed is List Price. To view your GSA or VA contract pricing, log in using your account number, or become a registered user by contacting one of our Customer Service teams. You can also view your contract price by searching for this item(s) on GSA Advantage. To place an order, contact Fisher Scientific Customer Service.



Glutathione S-transferase (GST) gene fusion system
pGEX 5′ sequencing primer
Ready-to-use in sequencing double-stranded DNA inserted into pGEX Vectors
Provide Content Correction

We continue to work to improve your shopping experience and your feedback regarding this content is very important to us. Please use the form below to provide feedback related to the content on this product.

Product Title

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.

Cancel Submit