Promotional price valid on web orders only. Your contract pricing may differ. Interested in signing up for a dedicated account number?
Learn More

GE Healthcare Ready-To-Go T-Primed First-Strand Kit Available on GSA/VA Contract for Federal Government customers only.

Minimize pipetting errors, avoid cross-contamination and ensure optimal performance. GE Healthcare Ready-To-Go T-Primed First-Strand Kit provides 50 single-dose, ambient-temperature-stable, first-strand cDNA synthesis reactions for use in PCR.

Manufacturer:  GE Healthcare 27926301

Catalog No. 45-002-410


Add to cart

Description

Description

The Ready-to-Go kit provides 50 single-dose first-strand cDNA synthesis reactions, each containing NotI-(dT)18 Primer, Cloned FPLCpure M-MuLV Reverse Transcriptase, RNase Inhibitor, and nucleotides.
  • For synthesis of full-length first-strand cDNA templates from polyadenylated RNA for use in RT-PCR
  • Preformulated glassified reaction mixes minimize pipetting errors, avoid potential cross-contamination of subsequent PCR products, and ensure optimal performance from each reaction
  • Predispensed, glassified reaction mixes are highly suitable for research applications that use PCR to detect and quantify eukaryotic RNA species isolated from a variety of cell sources and tissue samples
  • Reaction mixes include NotI-(dT)18 primer in sufficient quantity to serve as a downstream PCR primer for performing 3 ft.-RACE; final reaction volume is 33µl once reconstituted

This product(s) resides on a Fisher Scientific GSA or VA contract. If you are viewing this page as a nonregistered user, the price(s) displayed is List Price. To view your GSA or VA contract pricing, log in using your account number, or become a registered user by contacting one of our Customer Service teams. You can also view your contract price by searching for this item(s) on GSA Advantage. To place an order, contact Fisher Scientific Customer Service.

Specifications

Specifications

The kit provides 50 single-dose, ambient-temperature-stable, first-strand cDNA synthesis reactions, each containing NotI-(dT)18 Primer, Cloned FPLCpure M-MuLV Reverse Transcriptase, RNase Inhibitor, and nucleotides.
First-strand reaction mix:
Room-temperature-stable preparation vitrified from a
buffered solution containing dATP, dCTP, dGTP, dTTP,
FPLCpure M-MuLV reverse transcriptase,
RNAguard™ (porcine), RNase/DNase-Free BSA, and Not I-d(T)18 primer
(5’-d[AACTGGAAGAATTCGCGGCCGCAGGAAT18]-3’).

Control mix:
Room-temperature-stable rabbit globin mRNA (10 ng)
and 50 pmol of 5’-specific-globin primer
(5’d[ACACTTCTGGTCCAGTCCGACTGAG]-3’).
50 reactions
First-Strand
Ready-To-Go T-Primed First-Strand Kit
Documents
Provide Content Correction

We continue to work to improve your shopping experience and your feedback regarding this content is very important to us. Please use the form below to provide feedback related to the content on this product.

Product Title

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.

Cancel Submit