C_102284893_10

• SNP ID: rs76372077
• Gene: CCR7
• Gene Name: C-C motif chemokine receptor 7
• Set Membership: -
• Chromosome Location: Chr.17: 40557483 - 40557483 on Build GRCh38
• Polymorphism: G/A, Transition substitution
• Context Sequence [VIC/FAM]:

  CTTGGGAACATGGTGAGGACAAAAT[G/A]ATGTCCAGGAGCCTTTTCTTTGGCC

Assay Details

Species:	Human
dbSNP Submissions:	NA
Phenotype:	MIM: 600242
Literature Links:	CCR7 PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global A (0.01) (0.99)	Caucasian - Not Available	CEPH (CEU) - Not Available
EAS A (0.00) (1.00)	African American - Not Available	YRI (Yoruba) - Not Available
SAS A (0.00) (1.00)	Chinese - Not Available	CHB (Han Chinese) - Not Available
AFR A (0.05) (0.95)	Japanese - Not Available	JPT (Japanese) - Not Available
EUR A (0.00) (1.00)
AMR A (0.00) (1.00)

CCR7 - C-C motif chemokine receptor 7
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_001301714.1		Intron			NP_001288643.1
NM_001301716.1		Intron			NP_001288645.1
NM_001301717.1		Intron			NP_001288646.1
NM_001301718.1		Intron			NP_001288647.1
NM_001838.3		Intron			NP_001829.1

More Information

Gene Ontology Categories:

Process(es)

establishment of T cell polarity
positive regulation of cell-matrix adhesion
dendritic cell chemotaxis
myeloid dendritic cell chemotaxis
positive regulation of dendritic cell antigen processing and presentation
positive regulation of hypersensitivity
positive regulation of humoral immune response
inflammatory response
immune response
G-protein coupled receptor signaling pathway
positive regulation of cytosolic calcium ion concentration
positive regulation of actin filament polymerization
positive regulation of pseudopodium assembly
ruffle organization
response to lipopolysaccharide
regulation of interferon-gamma production
positive regulation of interleukin-12 production
response to prostaglandin E
chemokine (C-C motif) ligand 19 signaling pathway
chemokine (C-C motif) ligand 21 signaling pathway
positive regulation of I-kappaB kinase/NF-kappaB signaling
positive regulation of phosphatidylinositol 3-kinase activity
negative thymic T cell selection
positive regulation of cell adhesion
positive regulation of protein kinase activity
positive regulation of JNK cascade
homeostasis of number of cells
regulation of interleukin-1 beta secretion
positive regulation of T cell receptor signaling pathway
release of sequestered calcium ion into cytosol
positive regulation of filopodium assembly
positive regulation of protein kinase B signaling
positive regulation of ERK1 and ERK2 cascade
cellular response to cytokine stimulus
response to nitric oxide
interleukin-12 secretion
positive regulation of neutrophil chemotaxis
activation of GTPase activity
lymphocyte migration into lymph node
mature conventional dendritic cell differentiation
negative regulation of leukocyte apoptotic process
positive regulation of cell motility
positive regulation of dendritic cell chemotaxis
positive regulation of immunological synapse formation
positive regulation of T cell costimulation
positive regulation of glycoprotein biosynthetic process involved in immunological synapse formation
regulation of dendritic cell dendrite assembly

Function(s)

G-protein coupled receptor activity
C-C chemokine receptor activity
chemokine (C-C motif) ligand 19 binding
chemokine (C-C motif) ligand 21 binding
C-C motif chemokine 19 receptor activity
C-C motif chemokine 21 receptor activity