C_104872656_10

• SNP ID: rs78421006
• Gene: CELSR2
• Gene Name: cadherin EGF LAG seven-pass G-type receptor 2
• Set Membership: -
• Chromosome Location: Chr.1: 109256373 - 109256373 on Build GRCh38
• Polymorphism: A/G, Transition substitution
• Context Sequence [VIC/FAM]:

  ACAAGCAGGCTTGCTGGTGAGAGCT[A/G]GTGAGAATAAGCAAGTGATGAGGCT

Assay Details

Species:	Human
dbSNP Submissions:	14 submissions
Phenotype:	MIM: 604265
Literature Links:	CELSR2 PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global G (0.01) (0.99)	Caucasian - Not Available	CEPH (CEU) - Not Available
EAS G (0.00) (1.00)	African American - Not Available	YRI (Yoruba) - Not Available
SAS G (0.03) (0.97)	Chinese - Not Available	CHB (Han Chinese) - Not Available
AFR G (0.00) (1.00)	Japanese - Not Available	JPT (Japanese) - Not Available
EUR G (0.02) (0.98)
AMR G (0.00) (1.00)

CELSR2 - cadherin EGF LAG seven-pass G-type receptor 2
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_001408.2		Intron			NP_001399.1
XM_005270580.4		Intron			XP_005270637.1

More Information

Panther Classification:

Molecular Function -

cadherin

Gene Ontology Categories:

Process(es)

regulation of transcription, DNA-templated
homophilic cell adhesion via plasma membrane adhesion molecules
G-protein coupled receptor signaling pathway
spermatogenesis
Wnt signaling pathway
neural plate anterior/posterior regionalization
regulation of cell-cell adhesion
dendrite morphogenesis
Wnt signaling pathway, planar cell polarity pathway

Function(s)

G-protein coupled receptor activity
calcium ion binding