C_105235938_10

• SNP ID: rs79353147
• Gene: CAPN2
• Gene Name: calpain 2
• Set Membership: -
• Chromosome Location: Chr.1: 223739826 - 223739826 on Build GRCh38
• Polymorphism: G/A, Transition substitution
• Context Sequence [VIC/FAM]:

  GGAAGGCACCCTCAGGGGCTTTCCT[G/A]GAGCTAAAAACAGTTTAAGCCAAAA

Assay Details

Species:	Human
dbSNP Submissions:	14 submissions
Phenotype:	MIM: 114230
Literature Links:	CAPN2 PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global A (0.03) (0.97)	Caucasian - Not Available	CEPH (CEU) - Not Available
EAS A (0.00) (1.00)	African American - Not Available	YRI (Yoruba) - Not Available
SAS A (0.00) (1.00)	Chinese - Not Available	CHB (Han Chinese) - Not Available
AFR A (0.11) (0.89)	Japanese - Not Available	JPT (Japanese) - Not Available
EUR A (0.00) (1.00)
AMR A (0.01) (0.99)

CAPN2 - calpain 2
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_001146068.1		Intron			NP_001139540.1
NM_001748.4		Intron			NP_001739.2
XM_011544286.2		Intron			XP_011542588.1

More Information

Panther Classification:

Molecular Function -

cysteine protease

Gene Ontology Categories:

Process(es)

response to hypoxia
blastocyst development
proteolysis
myoblast fusion
protein autoprocessing
extracellular matrix disassembly
regulation of cytoskeleton organization
proteolysis involved in cellular protein catabolic process
cellular response to amino acid stimulus

Function(s)

calcium-dependent cysteine-type endopeptidase activity
calcium ion binding
protein binding
cytoskeletal protein binding
cysteine-type peptidase activity
protein heterodimerization activity