C_105322488_10

SNP ID:

rs80307381

Gene

MIR6842 PTK2B

Gene Name

microRNA 6842

protein tyrosine kinase 2 beta

Set Membership:

-

Chromosome Location:

Chr.8: 27436631 - 27436631 on Build GRCh38

Polymorphism:

C/T, Transition substitution

Context Sequence [VIC/FAM]:

TGGTGGGAGAATACAAAGGGGGAGG[C/T]GGGATAAAGACAGTTCTGAGAAAAG

Assay Details

Species:	Human
dbSNP Submissions:	NA
Phenotype:	MIM: 601212
Literature Links:	MIR6842 PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global T (0.03) (0.97)	Caucasian - Not Available	CEPH (CEU) - Not Available
EAS T (0.00) (1.00)	African American - Not Available	YRI (Yoruba) - Not Available
SAS T (0.00) (1.00)	Chinese - Not Available	CHB (Han Chinese) - Not Available
AFR T (0.11) (0.89)	Japanese - Not Available	JPT (Japanese) - Not Available
EUR T (0.00) (1.00)
AMR T (0.01) (0.99)

MIR6842 - microRNA 6842
There are no transcripts associated with this gene.

PTK2B - protein tyrosine kinase 2 beta
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_004103.4		Intron			NP_004094.3
NM_173174.2		Intron			NP_775266.1
NM_173175.2		Intron			NP_775267.1
NM_173176.2		Intron			NP_775268.1
XM_005273447.4		Intron			XP_005273504.1
XM_005273448.4		Intron			XP_005273505.1
XM_011544441.2		Intron			XP_011542743.1
XM_011544442.2		Intron			XP_011542744.1
XM_017013214.1		Intron			XP_016868703.1
XM_017013215.1		Intron			XP_016868704.1
XM_017013216.1		Intron			XP_016868705.1

More Information

Gene Ontology Categories:

Process(es)

MAPK cascade
angiogenesis
oocyte maturation
response to hypoxia
positive regulation of cell-matrix adhesion
sprouting angiogenesis
adaptive immune response
marginal zone B cell differentiation
protein complex assembly
protein phosphorylation
apoptotic process
response to stress
cellular defense response
response to osmotic stress
signal transduction
cell surface receptor signaling pathway
signal complex assembly
epidermal growth factor receptor signaling pathway
positive regulation of cytosolic calcium ion concentration
integrin-mediated signaling pathway
positive regulation of cell proliferation
negative regulation of cell proliferation
regulation of cell shape
response to mechanical stimulus
response to hormone
response to glucose
response to lithium ion
positive regulation of endothelial cell migration
negative regulation of muscle cell apoptotic process
regulation of cGMP-mediated signaling
regulation of macrophage chemotaxis
positive regulation of neuron projection development
glial cell proliferation
peptidyl-tyrosine phosphorylation
regulation of cell adhesion
positive regulation of cell growth
positive regulation of cell migration
negative regulation of bone mineralization
regulation of cGMP biosynthetic process
positive regulation of actin filament polymerization
neuron projection development
regulation of inositol trisphosphate biosynthetic process
tumor necrosis factor-mediated signaling pathway
ionotropic glutamate receptor signaling pathway
response to immobilization stress
peptidyl-tyrosine autophosphorylation
response to cocaine
response to drug
response to hydrogen peroxide
activation of Janus kinase activity
negative regulation of apoptotic process
stress fiber assembly
negative regulation of potassium ion transport
positive regulation of JUN kinase activity
negative regulation of neuron apoptotic process
blood vessel endothelial cell migration
positive regulation of phosphatidylinositol 3-kinase activity
innate immune response
positive regulation of nitric oxide biosynthetic process
bone resorption
response to ethanol
negative regulation of myeloid cell differentiation
positive regulation of translation
positive regulation of angiogenesis
positive regulation of protein kinase activity
positive regulation of JNK cascade
protein autophosphorylation
vascular endothelial growth factor receptor signaling pathway
focal adhesion assembly
positive regulation of peptidyl-tyrosine phosphorylation
regulation of calcium-mediated signaling
positive regulation of nitric-oxide synthase activity
regulation of release of sequestered calcium ion into cytosol
response to cAMP
response to calcium ion
positive regulation of synaptic transmission, glutamatergic
long-term synaptic potentiation
long term synaptic depression
chemokine-mediated signaling pathway
positive regulation of ERK1 and ERK2 cascade
cellular response to retinoic acid
cellular response to fluid shear stress
activation of GTPase activity
regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process
positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process
regulation of establishment of cell polarity
regulation of actin cytoskeleton reorganization
regulation of N-methyl-D-aspartate selective glutamate receptor activity
positive regulation of excitatory postsynaptic potential
positive regulation of B cell chemotaxis
positive regulation of DNA biosynthetic process

Function(s)

calmodulin-dependent protein kinase activity
protein tyrosine kinase activity
non-membrane spanning protein tyrosine kinase activity
signal transducer activity
NMDA glutamate receptor activity
receptor binding
protein binding
ATP binding
protein complex binding
3-phosphoinositide-dependent protein kinase binding