C_105405993_10

SNP ID:

rs76397586

Gene

ANAPC15 LAMTOR1 LRTOMT

Gene Name

anaphase promoting complex subunit 15

late endosomal/lysosomal adaptor, MAPK and MTOR activator 1

leucine rich transmembrane and O-methyltransferase domain containing

Set Membership:

-

Chromosome Location:

Chr.11: 72100511 - 72100511 on Build GRCh38

Polymorphism:

C/G, Transversion substitution

Context Sequence [VIC/FAM]:

CATCAGCTGCAAATCCTTGCTTGCT[C/G]TATCAGCAGTAAATGAGAAAAACAG

Assay Details

Species:	Human
dbSNP Submissions:	NA
Phenotype:	MIM: 614717 MIM: 613510 MIM: 612414
Literature Links:	ANAPC15 PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global C (0.01) (0.99)	Caucasian - Not Available	CEPH (CEU) - Not Available
EAS C (0.00) (1.00)	African American - Not Available	YRI (Yoruba) - Not Available
SAS C (0.00) (1.00)	Chinese - Not Available	CHB (Han Chinese) - Not Available
AFR C (0.00) (1.00)	Japanese - Not Available	JPT (Japanese) - Not Available
EUR C (0.02) (0.98)
AMR C (0.02) (0.98)

ANAPC15 - anaphase promoting complex subunit 15
There are no transcripts associated with this gene.

LAMTOR1 - late endosomal/lysosomal adaptor, MAPK and MTOR activator 1
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_017907.2		Intron			NP_060377.1

LRTOMT - leucine rich transmembrane and O-methyltransferase domain containing
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_001145307.4		Intron			NP_001138779.1
NM_001145308.4		Intron			NP_001138780.1
NM_001145309.3		Intron			NP_001138781.1
NM_001145310.3		Intron			NP_001138782.1
NM_001205138.3		Intron			NP_001192067.1
NM_001271471.2		Intron			NP_001258400.1
NM_001318803.1		Intron			NP_001305732.1
NM_145309.5		Intron			NP_660352.1
XM_006718473.3		Intron			XP_006718536.1
XM_006718474.3		Intron			XP_006718537.1
XM_011544847.2		Intron			XP_011543149.1
XM_011544848.2		Intron			XP_011543150.1
XM_017017356.1		Intron			XP_016872845.1
XM_017017357.1		Intron			XP_016872846.1
XM_017017358.1		Intron			XP_016872847.1
XM_017017359.1		Intron			XP_016872848.1
XM_017017360.1		Intron			XP_016872849.1

More Information

Panther Classification:

Molecular Function -

methyltransferase

Gene Ontology Categories:

Process(es)

regulation of receptor recycling
endosome organization
lysosome organization
cell cycle arrest
regulation of cholesterol esterification
regulation of cholesterol efflux
cell growth
macroautophagy
positive regulation of TOR signaling
lysosome localization
endosome localization
cellular protein localization
cholesterol homeostasis
positive regulation of MAPK cascade
positive regulation of GTPase activity
regulation of cholesterol import
cellular response to amino acid stimulus
sensory perception of sound
methylation
neurotransmitter catabolic process
catecholamine catabolic process
auditory receptor cell development

Function(s)

guanyl-nucleotide exchange factor activity
protein binding
protein complex scaffold
catechol O-methyltransferase activity