C_168066037_10

• SNP ID: rs140060883
• Gene: RGPD1
• Gene Name: RANBP2-like and GRIP domain containing 1
• Set Membership: -
• Chromosome Location: Chr.2: 86944036 - 86944036 on Build GRCh38
• Polymorphism: C/T, Transition substitution
• Context Sequence [VIC/FAM]:

  AAAAAAACAAAAAAAAACCAAAAAA[C/T]GGAAACTCAACGGATGACCATGATT

Assay Details

Species:	Human
dbSNP Submissions:	NA
Phenotype:	MIM: 612704
Literature Links:	RGPD1 PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global T (0.00) (1.00)	Caucasian - Not Available	CEPH (CEU) - Not Available
EAS T (0.00) (1.00)	African American - Not Available	YRI (Yoruba) - Not Available
SAS T (0.00) (1.00)	Chinese - Not Available	CHB (Han Chinese) - Not Available
AFR T (0.00) (1.00)	Japanese - Not Available	JPT (Japanese) - Not Available
EUR T (0.00) (1.00)
AMR T (0.00) (1.00)

RGPD1 - RANBP2-like and GRIP domain containing 1
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_001024457.3		Intron			NP_001019628.3
XM_011532845.2		Intron			XP_011531147.1
XM_011532849.2		Intron			XP_011531151.1
XM_011532850.1		Intron			XP_011531152.1
XM_011532851.2		Intron			XP_011531153.1
XM_011532852.2		Intron			XP_011531154.1
XM_017004103.1		Intron			XP_016859592.1
XM_017004104.1		Intron			XP_016859593.1
XM_017004105.1		Intron			XP_016859594.1
XM_017004106.1		Intron			XP_016859595.1
XM_017004107.1		Intron			XP_016859596.1

More Information

Panther Classification:

Molecular Function -

scaffold/adaptor protein

Gene Ontology Categories:

Process(es)

protein targeting to Golgi