C_168453217_10

SNP ID:

rs144965345

Gene

CTNNA2 LRRTM1

Gene Name

catenin alpha 2

leucine rich repeat transmembrane neuronal 1

Set Membership:

-

Chromosome Location:

Chr.2: 80302371 - 80302371 on Build GRCh38

Polymorphism:

C/G, Transversion substitution

Context Sequence [VIC/FAM]:

AATCAACGTAGTATTCCTGGGCAGA[C/G]ATGGCAGCCATCTGATGCATGGTCT

Assay Details

Species:	Human
dbSNP Submissions:	NA
Phenotype:	MIM: 114025 MIM: 610867
Literature Links:	CTNNA2 PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global - Not Available	Caucasian - Not Available	CEPH (CEU) - Not Available
EAS - Not Available	African American - Not Available	YRI (Yoruba) - Not Available
SAS - Not Available	Chinese - Not Available	CHB (Han Chinese) - Not Available
AFR - Not Available	Japanese - Not Available	JPT (Japanese) - Not Available
EUR - Not Available
AMR - Not Available

CTNNA2 - catenin alpha 2
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_001164883.1	1719	Intron			NP_001158355.1
NM_001282597.2	1719	Intron			NP_001269526.1
NM_001282598.1	1719	Intron			NP_001269527.1
NM_001282599.1	1719	Intron			NP_001269528.1
NM_001282600.1	1719	Intron			NP_001269529.1
NM_001320810.1	1719	Intron			NP_001307739.1
NM_004389.3	1719	Intron			NP_004380.2
XM_011532555.2	1719	Intron			XP_011530857.1
XM_011532556.2	1719	Intron			XP_011530858.1
XM_011532557.2	1719	Intron			XP_011530859.1
XM_017003403.1	1719	Intron			XP_016858892.1
XM_017003404.1	1719	Intron			XP_016858893.1
XM_017003405.1	1719	Intron			XP_016858894.1
XM_017003406.1	1719	Intron			XP_016858895.1

LRRTM1 - leucine rich repeat transmembrane neuronal 1
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_178839.4	1719	Missense Mutation	ATC,ATG	I,M 483	NP_849161.2
XM_017003986.1	1719	Missense Mutation	ATC,ATG	I,M 483	XP_016859475.1
XM_017003987.1	1719	Missense Mutation	ATC,ATG	I,M 483	XP_016859476.1

More Information

Panther Classification:

Molecular Function -

non-motor actin binding protein, transmembrane signal receptor

Gene Ontology Categories:

Process(es)

cytoskeleton organization
axonogenesis
single organismal cell-cell adhesion
radial glia guided migration of Purkinje cell
dendrite morphogenesis
brain morphogenesis
positive regulation of muscle cell differentiation
regulation of synapse structural plasticity
prepulse inhibition
negative regulation of receptor internalization
negative regulation of protein kinase activity
locomotory behavior
biological_process
cytokine-mediated signaling pathway
protein localization to synapse
exploration behavior
negative regulation of JAK-STAT cascade
synapse organization
positive regulation of synapse assembly
long-term synaptic potentiation

Function(s)

structural constituent of cytoskeleton
protein binding
actin filament binding
cadherin binding involved in cell-cell adhesion
molecular_function
protein kinase inhibitor activity