C_190359710_10

• SNP ID: rs202213083
• Gene: CCL23
• Gene Name: C-C motif chemokine ligand 23
• Set Membership: -
• Chromosome Location: Chr.17: 36013220 - 36013220 on Build GRCh38
• Polymorphism: A/G, Transition substitution
• Context Sequence [VIC/FAM]:

  GTTCAATTCTTCCTGGTCTTGATCC[A/G]TGTGTCCAGCTTCAGCATTCTCATG

Assay Details

Species:	Human
dbSNP Submissions:	NA
Phenotype:	MIM: 602494
Literature Links:	CCL23 PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global - Not Available	Caucasian - Not Available	CEPH (CEU) - Not Available
EAS - Not Available	African American - Not Available	YRI (Yoruba) - Not Available
SAS - Not Available	Chinese - Not Available	CHB (Han Chinese) - Not Available
AFR - Not Available	Japanese - Not Available	JPT (Japanese) - Not Available
EUR - Not Available
AMR - Not Available

CCL23 - C-C motif chemokine ligand 23
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_005064.5	462	Missense Mutation	CGG,TGG	R,W 131	NP_005055.3
NM_145898.3	462	Missense Mutation	CGG,TGG	R,W 114	NP_665905.2

More Information

Panther Classification:

Molecular Function -

cytokine, intercellular signal molecule

Gene Ontology Categories:

Process(es)

monocyte chemotaxis
cellular calcium ion homeostasis
chemotaxis
inflammatory response
immune response
signal transduction
G-protein coupled receptor signaling pathway
cell-cell signaling
negative regulation of cell proliferation
neutrophil chemotaxis
positive regulation of GTPase activity
lymphocyte chemotaxis
positive regulation of inflammatory response
chemokine-mediated signaling pathway
positive regulation of ERK1 and ERK2 cascade
cellular response to interferon-gamma
cellular response to interleukin-1
cellular response to tumor necrosis factor
negative regulation of C-C chemokine binding

Function(s)

chemokine activity
heparin binding
CCR1 chemokine receptor binding