C_192163291_10

SNP ID:

rs202139382

Gene

GBA2 MSMP NPR2 RGP1

Gene Name

glucosylceramidase beta 2

microseminoprotein, prostate associated

natriuretic peptide receptor 2

RGP1 homolog, RAB6A GEF complex partner 1

Set Membership:

-

Chromosome Location:

Chr.9: 35753106 - 35753106 on Build GRCh38

Polymorphism:

G/T, Transversion substitution

Context Sequence [VIC/FAM]:

GATGGATGATCAGTTGAGTTTAGCT[G/T]GAGTGGGGAGCAGGAGCCCCAGGAA

Assay Details

Species:	Human
dbSNP Submissions:	NA
Phenotype:	MIM: 609471 MIM: 612191 MIM: 108961 MIM: 615742
Literature Links:	GBA2 PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global - Not Available	Caucasian - Not Available	CEPH (CEU) - Not Available
EAS - Not Available	African American - Not Available	YRI (Yoruba) - Not Available
SAS - Not Available	Chinese - Not Available	CHB (Han Chinese) - Not Available
AFR - Not Available	Japanese - Not Available	JPT (Japanese) - Not Available
EUR - Not Available
AMR - Not Available

GBA2 - glucosylceramidase beta 2
There are no transcripts associated with this gene.

MSMP - microseminoprotein, prostate associated
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_001044264.2	162	Silent Mutation	TCA,TCC	S,S 138	NP_001037729.1

NPR2 - natriuretic peptide receptor 2
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_003995.3	162	Intron			NP_003986.2
XM_005251478.3	162	Intron			XP_005251535.1
XM_005251479.4	162	UTR 5			XP_005251536.1
XM_011517890.2	162	UTR 5			XP_011516192.1
XM_011517891.2	162	UTR 5			XP_011516193.1
XM_011517892.2	162	UTR 5			XP_011516194.1
XM_011517893.2	162	UTR 5			XP_011516195.1
XM_011517895.2	162	Intron			XP_011516197.1
XM_017014745.1	162	UTR 5			XP_016870234.1
XM_017014746.1	162	UTR 5			XP_016870235.1
XM_017014747.1	162	UTR 5			XP_016870236.1
XM_017014748.1	162	UTR 5			XP_016870237.1
XM_017014749.1	162	UTR 5			XP_016870238.1
XM_017014750.1	162	UTR 5			XP_016870239.1

RGP1 - RGP1 homolog, RAB6A GEF complex partner 1
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_001080496.2	162	UTR 3			NP_001073965.2

More Information

Panther Classification:

Molecular Function -

intercellular signal molecule, guanylate cyclase

Gene Ontology Categories:

Process(es)

biological_process
ossification
cGMP biosynthetic process
protein phosphorylation
receptor guanylyl cyclase signaling pathway
regulation of blood pressure
intracellular signal transduction
single organism reproductive process
negative regulation of meiotic cell cycle
bone development
cellular response to granulocyte macrophage colony-stimulating factor stimulus
negative regulation of oocyte maturation
regulation of cardiac conduction
retrograde transport, endosome to Golgi
positive regulation of GTPase activity
negative regulation of cellular protein catabolic process

Function(s)

molecular_function
adenylate cyclase activity
guanylate cyclase activity
protein kinase activity
ATP binding
GTP binding
natriuretic peptide receptor activity
peptide hormone binding
hormone binding
identical protein binding
protein binding
Rab guanyl-nucleotide exchange factor activity
Rab GTPase binding