C_30634117C_K0

SNP ID:

rs5030865

Gene

CYP2D6 LOC102723722 NDUFA6-AS1

Gene Name

cytochrome P450 family 2 subfamily D member 6

uncharacterized LOC102723722

NDUFA6 antisense RNA 1 (head to head)

Set Membership:

> DME > Validated > Inventoried

Chromosome Location:

Chr.22: 42129033 - 42129033 on Build GRCh38

Polymorphism:

A/C, Transversion substitution

Context Sequence [VIC/FAM]:

TTGTGCCCTTCTGCCCATCACCCAC[A/C]GGAGTGGTTGGCGAAGGCGGCACAA

Assay Details

Species:	Human
dbSNP Submissions:	NA
Phenotype:	MIM: 124030
Literature Links:	CYP2D6 PubMed Links
Allele Nomenclature:	CYP2D6*14A,g.1758G>A CYP2D6*14B,g.1758G>A CYP2D6*8,g.1758G>T
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global T (0.00) (1.00)	Caucasian A (0.00) (1.00)	CEPH (CEU) - Not Available
EAS T (0.01) (0.99)	Caucasian T (0.00) (1.00)	YRI (Yoruba) - Not Available
SAS T (0.00) (1.00)	Caucasian A (0.00) (1.00)	CHB (Han Chinese) - Not Available
AFR T (0.00) (1.00)	Caucasian T (0.00) (1.00)	JPT (Japanese) - Not Available
EUR T (0.00) (1.00)	African American T (0.00) (1.00)
AMR T (0.00) (1.00)	African American A (0.00) (1.00)
	African American A (0.00) (1.00)
	African American T (0.00) (1.00)
	Japanese A (0.00) (1.00)
	Japanese T (0.00) (1.00)
	Japanese A (0.00) (1.00)
	Japanese T (0.00) (1.00)
	Chinese T (0.00) (1.00)
	Chinese A (0.00) (1.00)
	Chinese A (0.00) (1.00)
	Chinese T (0.01) (0.99)

CYP2D6 - cytochrome P450 family 2 subfamily D member 6
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_000106.5	595	Missense Mutation			NP_000097.3
NM_001025161.2	595	Intron			NP_001020332.2
XM_011529966.2	595	Intron			XP_011528268.1
XM_011529968.2	595	Intron			XP_011528270.1
XM_011529970.2	595	Intron			XP_011528272.1
XM_011529972.2	595	Intron			XP_011528274.1

LOC102723722 - uncharacterized LOC102723722
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
XM_017029174.1	595	Intron			XP_016884663.1

NDUFA6-AS1 - NDUFA6 antisense RNA 1 (head to head)
There are no transcripts associated with this gene.

More Information

Important Information

Assay C_30634117C_K0 reports the major (G) and one minor (T) allele (CYP2D6*8, g.1758G>T) of a triallelic SNP. Assay C_30634117D_M0 reports the major (G) and other minor (A) allele (CYP2D6*14, g.1758G>A). The minor alleles are rare, thus there is a low risk that sample genotypes could be miscalled by an assay due to the presence of the unreported minor allele. To accurately determine sample genotypes, run both assays separately on the same samples and analyze data as described in the PGx Experiments User Guide (Pub. # MAN0009612) Chapter 5 section 'TaqMan DME genotyping assays to triallelic SNPs and adjacent SNP targets'.
Assay C_30634117D_M0 reports the major (G) and other minor (A) allele (CYP2D6*14, g.1758G>A).

Additional Information:

The CYP2D6 gene exhibits copy number variation. Individuals may carry deletion alleles or extra copies of CYP2D6. CYP2D6 SNP genotyping assays run on samples lacking CYP2D6 genes will not amplify, homozygous samples having 1 or more gene copies typically cluster together, and heterozygous samples with more than 2 copies may run between the 2 copy heterozygous and homozygous genotype clusters. In addition, some CYP2D6 alleles contain CYP2D7 pseudogene sequences. For accurate CYP2D6 genotype analysis, copy number analysis must be done. For more information, refer to the PGx Experiments User Guide (Pub. # MAN0009612) Chapter 2 Copy Number Variation section.

• Set Membership: DME, Validated, Inventoried

Panther Classification:

Molecular Function -

oxidoreductase, oxygenase, metabolite interconversion enzyme

Gene Ontology Categories:

Process(es)

xenobiotic metabolic process
steroid metabolic process
coumarin metabolic process
alkaloid metabolic process
alkaloid catabolic process
monoterpenoid metabolic process
drug metabolic process
arachidonic acid metabolic process
isoquinoline alkaloid metabolic process
drug catabolic process
heterocycle metabolic process
negative regulation of binding
oxidation-reduction process
oxidative demethylation
negative regulation of cellular organofluorine metabolic process

Function(s)

monooxygenase activity
iron ion binding
drug binding
arachidonic acid epoxygenase activity
steroid hydroxylase activity
oxidoreductase activity
oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen
oxygen binding
heme binding
aromatase activity