C_359188783_10

SNP ID:

rs544476029

Gene

CHRM3 CHRM3-AS1

Gene Name

cholinergic receptor muscarinic 3

CHRM3 antisense RNA 1

Set Membership:

-

Chromosome Location:

Chr.1: 239899464 - 239899464 on Build GRCh38

Polymorphism:

G/A, Transition substitution

Context Sequence [VIC/FAM]:

ATGTATATGATATGTATATACATAC[G/A]TATATATGTGTGTATATATACTCAC

Assay Details

Species:	Human
dbSNP Submissions:	5 submissions
Phenotype:	MIM: 118494
Literature Links:	CHRM3 PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global - Not Available	Caucasian - Not Available	CEPH (CEU) - Not Available
EAS - Not Available	African American - Not Available	YRI (Yoruba) - Not Available
SAS - Not Available	Chinese - Not Available	CHB (Han Chinese) - Not Available
AFR - Not Available	Japanese - Not Available	JPT (Japanese) - Not Available
EUR - Not Available
AMR - Not Available

CHRM3 - cholinergic receptor muscarinic 3
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_000740.2		Intron			NP_000731.1
XM_005273032.3		Intron			XP_005273089.1
XM_011544041.2		Intron			XP_011542343.1
XM_011544043.2		Intron			XP_011542345.1
XM_011544044.2		Intron			XP_011542346.1
XM_011544045.2		Intron			XP_011542347.1
XM_011544046.2		Intron			XP_011542348.1
XM_011544047.2		Intron			XP_011542349.1
XM_017000152.1		Intron			XP_016855641.1
XM_017000153.1		Intron			XP_016855642.1
XM_017000154.1		Intron			XP_016855643.1
XM_017000155.1		Intron			XP_016855644.1
XM_017000156.1		Intron			XP_016855645.1
XM_017000157.1		Intron			XP_016855646.1
XM_017000158.1		Intron			XP_016855647.1
XM_017000159.1		Intron			XP_016855648.1
XM_017000160.1		Intron			XP_016855649.1
XM_017000161.1		Intron			XP_016855650.1
XM_017000162.1		Intron			XP_016855651.1
XM_017000163.1		Intron			XP_016855652.1

CHRM3-AS1 - CHRM3 antisense RNA 1
There are no transcripts associated with this gene.

More Information

Panther Classification:

Molecular Function -

G-protein coupled receptor

Gene Ontology Categories:

Process(es)

regulation of vascular smooth muscle contraction
cellular protein modification process
smooth muscle contraction
signal transduction
G-protein coupled receptor signaling pathway
adenylate cyclase-inhibiting G-protein coupled acetylcholine receptor signaling pathway
phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway
G-protein coupled acetylcholine receptor signaling pathway
synaptic transmission, cholinergic
nervous system development
cell proliferation
positive regulation of smooth muscle contraction
saliva secretion

Function(s)

phosphatidylinositol phospholipase C activity
receptor activity
protein binding
drug binding
G-protein coupled acetylcholine receptor activity
acetylcholine binding