C_371822333_10

SNP ID:

rs764450761

Gene

RANBP2 SH3RF3

Gene Name

RAN binding protein 2

SH3 domain containing ring finger 3

Set Membership:

-

Chromosome Location:

Chr.2: 109277606 - 109277606 on Build GRCh38

Polymorphism:

G/T, Transversion substitution

Context Sequence [VIC/FAM]:

GTTATCTATCACCCTGCACTCCTCC[G/T]CGTGCGTAGCTCAGAACTGACTCTG

Assay Details

Species:	Human
dbSNP Submissions:	NA
Phenotype:	MIM: 601181
Literature Links:	RANBP2 PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global - Not Available	Caucasian - Not Available	CEPH (CEU) - Not Available
EAS - Not Available	African American - Not Available	YRI (Yoruba) - Not Available
SAS - Not Available	Chinese - Not Available	CHB (Han Chinese) - Not Available
AFR - Not Available	Japanese - Not Available	JPT (Japanese) - Not Available
EUR - Not Available
AMR - Not Available

RANBP2 - RAN binding protein 2
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_006267.4		Intron			NP_006258.3
XM_005264002.2		Intron			XP_005264059.1
XM_005264003.2		Intron			XP_005264060.1
XM_005264004.2		Intron			XP_005264061.1
XM_005264005.4		Intron			XP_005264062.1
XM_005264007.2		Intron			XP_005264064.1
XM_011511575.2		Intron			XP_011509877.1
XM_011511576.2		Intron			XP_011509878.1
XM_011511578.2		Intron			XP_011509880.1
XM_017004623.1		Intron			XP_016860112.1
XM_017004624.1		Intron			XP_016860113.1
XM_017004625.1		Intron			XP_016860114.1

SH3RF3 - SH3 domain containing ring finger 3
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_001099289.2		Intron			NP_001092759.1
XM_011511109.2		Intron			XP_011509411.1
XM_011511110.2		Intron			XP_011509412.1

More Information

Panther Classification:

Molecular Function -

scaffold/adaptor protein

Gene Ontology Categories:

Process(es)

protein peptidyl-prolyl isomerization
mRNA export from nucleus
tRNA export from nucleus
protein folding
NLS-bearing protein import into nucleus
sister chromatid cohesion
mitotic nuclear envelope disassembly
regulation of glucose transport
viral process
protein sumoylation
viral transcription
gene silencing by RNA
negative regulation of glucokinase activity
intracellular transport of virus
regulation of gluconeogenesis involved in cellular glucose homeostasis
regulation of cellular response to heat

Function(s)

RNA binding
peptidyl-prolyl cis-trans isomerase activity
protein binding
zinc ion binding
Ran GTPase binding
ligase activity
SUMO transferase activity