C_378065557_10

• SNP ID: rs747109307
• Gene: RARB
• Gene Name: retinoic acid receptor beta
• Set Membership: -
• Chromosome Location: Chr.3: 25512722 - 25512722 on Build GRCh38
• Polymorphism: T/A, Transversion substitution
• Context Sequence [VIC/FAM]:

  GACACACTTTTCTAACAGCAAGGAG[T/A]GTGTGTGGGTCACTCTTGCCTCTCC

Assay Details

Species:	Human
dbSNP Submissions:	NA
Phenotype:	MIM: 180220
Literature Links:	RARB PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global - Not Available	Caucasian - Not Available	CEPH (CEU) - Not Available
EAS - Not Available	African American - Not Available	YRI (Yoruba) - Not Available
SAS - Not Available	Chinese - Not Available	CHB (Han Chinese) - Not Available
AFR - Not Available	Japanese - Not Available	JPT (Japanese) - Not Available
EUR - Not Available
AMR - Not Available

RARB - retinoic acid receptor beta
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_000965.4		Intron			NP_000956.2
NM_001290216.2		Intron			NP_001277145.1
NM_001290217.1		Intron			NP_001277146.1
NM_001290266.1		Intron			NP_001277195.1
NM_001290276.1		Intron			NP_001277205.1
NM_001290277.1		Intron			NP_001277206.1
NM_001290300.1		Intron			NP_001277229.1
NM_016152.3		Intron			NP_057236.1

More Information

Panther Classification:

Molecular Function -

C4 zinc finger nuclear receptor

Gene Ontology Categories:

Process(es)

negative regulation of transcription from RNA polymerase II promoter
ureteric bud development
glandular epithelial cell development
outflow tract septum morphogenesis
retinal pigment epithelium development
growth plate cartilage development
transcription initiation from RNA polymerase II promoter
signal transduction
positive regulation of cell proliferation
negative regulation of cell proliferation
striatum development
regulation of myelination
negative regulation of chondrocyte differentiation
embryonic hindlimb morphogenesis
multicellular organism growth
positive regulation of apoptotic process
negative regulation of apoptotic process
steroid hormone mediated signaling pathway
positive regulation of neuron differentiation
positive regulation of transcription from RNA polymerase II promoter
embryonic eye morphogenesis
retinoic acid receptor signaling pathway
embryonic digestive tract development
ventricular cardiac muscle cell differentiation

Function(s)

RNA polymerase II regulatory region sequence-specific DNA binding
DNA binding
steroid hormone receptor activity
retinoic acid receptor activity
drug binding
zinc ion binding
protein complex binding
retinoid X receptor binding