C__25640675_10

SNP ID:

rs9825651

Gene

CACNA2D3 LRTM1

Gene Name

calcium voltage-gated channel auxiliary subunit alpha2delta 3

leucine rich repeats and transmembrane domains 1

Set Membership:

-

Chromosome Location:

Chr.3: 54927980 - 54927980 on Build GRCh38

Polymorphism:

A/G, Transition substitution

Context Sequence [VIC/FAM]:

TAATTAATGTGCAGAGCAACACACG[A/G]AGGGCATGGCAGACTCAGAGCCCAG

Assay Details

Species:	Human
dbSNP Submissions:	NA
Phenotype:	MIM: 606399
Literature Links:	CACNA2D3 PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global G (0.06) (0.94)	Caucasian - Not Available	CEPH (CEU) - Not Available
EAS - Not Available	African American - Not Available	YRI (Yoruba) - Not Available
SAS - Not Available	Chinese - Not Available	CHB (Han Chinese) - Not Available
AFR - Not Available	Japanese - Not Available	JPT (Japanese) - Not Available
EUR - Not Available
AMR - Not Available

CACNA2D3 - calcium voltage-gated channel auxiliary subunit alpha2delta 3
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_018398.2	95	Intron			NP_060868.2
XM_005265318.2	95	Intron			XP_005265375.1
XM_011533946.2	95	Intron			XP_011532248.1
XM_011533947.2	95	Intron			XP_011532249.1
XM_011533948.2	95	Intron			XP_011532250.1
XM_011533949.2	95	Intron			XP_011532251.1
XM_011533950.2	95	Intron			XP_011532252.1
XM_011533951.2	95	Intron			XP_011532253.1
XM_011533952.2	95	Intron			XP_011532254.1
XM_011533953.2	95	Intron			XP_011532255.1
XM_011533954.2	95	Intron			XP_011532256.1
XM_011533955.1	95	Intron			XP_011532257.1
XM_017006850.1	95	Intron			XP_016862339.1
XM_017006851.1	95	Intron			XP_016862340.1
XM_017006852.1	95	Intron			XP_016862341.1
XM_017006853.1	95	Intron			XP_016862342.1
XM_017006854.1	95	Intron			XP_016862343.1

LRTM1 - leucine rich repeats and transmembrane domains 1
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_001304389.1	95	Intron			NP_001291318.1
NM_020678.3	95	UTR 5			NP_065729.1

More Information

Panther Classification:

Molecular Function -

voltage-gated ion channel

Gene Ontology Categories:

Process(es)

regulation of ion transmembrane transport
regulation of calcium ion transport
cardiac conduction
calcium ion transmembrane transport
negative regulation of protein kinase activity
cytokine-mediated signaling pathway
negative regulation of JAK-STAT cascade
positive regulation of synapse assembly

Function(s)

voltage-gated ion channel activity
calcium channel regulator activity
calcium channel activity
metal ion binding
protein kinase inhibitor activity