C___8953893_1_

• SNP ID: rs240358
• Gene: LARGE1
• Gene Name: LARGE xylosyl- and glucuronyltransferase 1
• Set Membership: > HapMap > Validated
• Chromosome Location: Chr.22: 33670398 - 33670398 on Build GRCh38
• Polymorphism: A/G, Transition substitution
• Context Sequence [VIC/FAM]:

  GACTCATCACGTACATGTTGAGATT[A/G]GAAAGGTGAGCACCAAGACGCTAGA

Assay Details

Species:	Human
dbSNP Submissions:	NA
Phenotype:	MIM: 603590
Literature Links:	LARGE1 PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global A (0.36) (0.64)	Caucasian A (0.32) (0.68)	CEPH (CEU) A (0.30) (0.70)
EAS A (0.48) (0.52)	African American A (0.22) (0.78)	YRI (Yoruba) A (0.10) (0.90)
SAS A (0.34) (0.66)	Chinese - Not Available	JPT (Japanese) G (0.48) (0.52)
AFR A (0.18) (0.82)	Japanese - Not Available	CHB (Han Chinese) G (0.46) (0.54)
EUR A (0.33) (0.67)
AMR G (0.41) (0.59)

LARGE1 - LARGE xylosyl- and glucuronyltransferase 1
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_004737.4		Intron			NP_004728.1
NM_133642.3		Intron			NP_598397.1
XM_005261831.3		Intron			XP_005261888.1
XM_005261832.3		Intron			XP_005261889.1
XM_011530510.2		Intron			XP_011528812.1
XM_011530512.2		Intron			XP_011528814.1
XM_011530513.2		Intron			XP_011528815.1
XM_011530514.2		Intron			XP_011528816.1

More Information

• Set Membership: HapMap, Validated

Panther Classification:

Molecular Function -

glycosyltransferase

Gene Ontology Categories:

Process(es)

N-acetylglucosamine metabolic process
protein glycosylation
protein O-linked glycosylation
glycosphingolipid biosynthetic process
glycoprotein biosynthetic process
protein O-linked mannosylation
skeletal muscle tissue regeneration
muscle cell cellular homeostasis
skeletal muscle organ development

Function(s)

acetylglucosaminyltransferase activity
glucuronosyltransferase activity
transferase activity, transferring glycosyl groups
manganese ion binding
UDP-xylosyltransferase activity
xylosyltransferase activity