C____518264_10

• SNP ID: rs7969743
• Gene: POLR3B
• Gene Name: RNA polymerase III subunit B
• Set Membership: > HapMap > Validated
• Chromosome Location: Chr.12: 106478441 - 106478441 on Build GRCh38
• Polymorphism: A/G, Transition substitution
• Context Sequence [VIC/FAM]:

  AGCTTTGACTTGTACGTCTCTTTGC[A/G]AAACTGAAGGAGTCCTCCTGGGTCT

Assay Details

Species:	Human
dbSNP Submissions:	NA
Phenotype:	MIM: 614366
Literature Links:	POLR3B PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global G (0.38) (0.62)	Caucasian G (0.29) (0.71)	CEPH (CEU) G (0.44) (0.56)
EAS G (0.06) (0.94)	African American A (0.36) (0.64)	YRI (Yoruba) A (0.30) (0.70)
SAS G (0.32) (0.68)	Chinese - Not Available	JPT (Japanese) G (0.06) (0.94)
AFR A (0.28) (0.72)	Japanese - Not Available	CHB (Han Chinese) G (0.04) (0.96)
EUR G (0.38) (0.62)
AMR G (0.32) (0.68)

POLR3B - RNA polymerase III subunit B
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_001160708.1		Intron			NP_001154180.1
NM_018082.5		Intron			NP_060552.4
XM_017019621.1		Intron			XP_016875110.1

More Information

• Set Membership: HapMap, Validated

Panther Classification:

Molecular Function -

DNA-directed RNA polymerase

Gene Ontology Categories:

Process(es)

transcription from RNA polymerase III promoter
positive regulation of type I interferon production
positive regulation of interferon-beta production
innate immune response
positive regulation of innate immune response
defense response to virus

Function(s)

RNA polymerase III activity
DNA binding
ribonucleoside binding
metal ion binding