Promotional price valid on web orders only. Your contract pricing may differ. Interested in signing up for a dedicated account number?
Learn More

Gene Tools LLC CCTCTTACCTCAGTTACAATTTATA
SDP

Supplier:  Gene Tools LLC OLIGO 100 NMOL

Encompass
missing translation for 'thirdPartyNoContent'

Catalog No. NC3823264


May include imposed supplier surcharges.
Only null left
Add to Cart

Product Title
Select an issue

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.