Promotional price valid on web orders only. Your contract pricing may differ. Interested in signing up for a dedicated account number?
Learn More

Medchemexpress LLC Tau ASO-12 (murine) (sodium) | 00-00-0 | 97.2% | 7619.00 Da | 5 MG
SDP

Supplier:  Medchemexpress LLC HY132582A5MG

Encompass_Preferred

Tau ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide intended for preclinical murine research. Supplied as the sodium salt in mg quantities, it is designed for studies of Tau biology and Alzheimer's disease models.

  • Tau-lowering antisense oligonucleotide for murine models.
  • Sequence: 5′ GCTTTTACTGACCATGCGAG 3′.
  • Formulation: sodium salt.
  • Molecular weight: 7619.00 Da.
  • Purity: 97.2%.
  • Storage: 4°C sealed; in solvent -80°C for 6 months, -20°C for 1 month.
  • Available sizes: 1 mg, 5 mg, 10 mg, 50 mg (quote for 50 mg).

Catalog No. 50-002-62371


May include imposed supplier surcharges.
Add to Cart

Product Title
Select an issue

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.