Promotional price valid on web orders only. Your contract pricing may differ. Interested in signing up for a dedicated account number?
Learn More
  1. Home
  2. Products
  3. NC2740362

HORIZON DISCOVERY BIOSCIENCES LIMITED Edit-R Human Synthetic ECT2 (1894) sgRNA Unit Size: 5 nmol

Catalog No. NC2740362
Encompass

Edit-R CRISPR (knockout) Human ECT2 Synthetic sgRNATarget sequence:GTGTATTAACATCCACTACTGenomic location:GRCh38.p14-combined:chr3:172754544-172754566:+

Catalog No. NC2740362 Supplier HORIZON DISCOVERY BIOSCIENCES LIMITED Supplier No. SG006450010005
May include imposed supplier surcharges.
Add to Cart
Add to Cart

missing translation for 'validMainframeMsg'

Edit-R CRISPR (knockout) Human ECT2 Synthetic sgRNATarget sequence:GTGTATTAACATCCACTACTGenomic location:GRCh38.p14-combined:chr3:172754544-172754566:+

Product Title
Select an issue

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.