Promotional price valid on web orders only. Your contract pricing may differ. Interested in signing up for a dedicated account number?
Learn More

Invitrogen™ ProQuest™ Two-Hybrid System with Gateway™ Technology

Catalog No. PQ1000101
Encompass_Preferred
Change view
Click to view available options
Quantity:
1 kit
1 product options available for selection
Product selection table with 1 available options. Use arrow keys to navigate and Enter or Space to select.
Catalog No. Quantity
PQ1000101 1 kit
Use arrow keys to navigate between rows. Press Enter or Space to select a product option. 1 options available.
1 options
Catalog No. PQ1000101 Supplier Invitrogen™ Supplier No. PQ1000101
Add to Cart
Add to Cart

missing translation for 'validMainframeMsg'

Includes

The ProQuest Two-Hybrid System includes yeast expression vectors pDEST32, pDEST22, and pEXP-AD502 for generation of GAL4 DNA Binding Domain and GAL4 Activation Domain fusion proteins, and LR Clonase II Enzyme Mix, a glycerol stock of the MaV203 yeast strain, as well as positive and negative controls for the two-hybrid assay.

An in vivo yeast-based system for identifying interactions between two proteins

  • Reconstitutes a functional transcription factor that activates chromosomally integrated reporter genes where transcriptional activation is monitored by the growth of cells on selective media
  • Allow rapid and easy generation of bait and prey constructs, and facilitate downstream application
  • Low copy-number DBD (DNA Binding Domain) and AD (Activation Domain) vectors (ARS/CEN) to control over-expression and increase reproducibility
  • Three different reporter genes (HIS3, URA3, and lacZ) with independent promoter regions to rapidly weed out false positives
  • URA3 reporter gene allows for both positive and negative selection, enabling advanced two-hybrid techniques such as reverse two-hybrid
  • A set of strong-to-weak Gateway-based control interactions to evaluate results and assess the strength of the interaction being tested

Protein-Protein Interactions, Proteins, Expression, Isolation and Analysis, Yeast Two-Hybrid

TRUSTED_SUSTAINABILITY

Specifications

Product Type Two-Hybrid System
Reporter Gene Beta-Gal (lacZ), HIS3, URA3
Content And Storage The ProQuest™ Two-Hybrid System includes yeast expression vectors pDEST™32, pDEST™22, and pEXP-AD502 for generation of GAL4 DNA Binding Domain and GAL4 Activation Domain fusion proteins, and LR Clonase™ II Enzyme Mix, a glycerol stock of the MaV203 yeast strain, as well as positive and negative controls for the two-hybrid assay. Store kit components at -80°C. Guaranteed stable for six months when properly stored.
Assay Two-Hybrid Assay
Expression System Yeast
Quantity 1 kit
Product Line Gateway, ProQuest
How large of a PCR product can I recombine with a pDONR vector via BP cloning? Does the same apply for TOPO-adapted Entry vectors?

There is no theoretical limit to insert size for a BP reaction with a pDONR vector. Maximum size tested in-house is 12 kb. TOPO vectors are more sensitive to insert size and 3-5 kb is the upper limit for decent cloning efficiency.

How should I clean up my attB-PCR product?

After generating your attB-PCR product, we recommend purifying it to remove PCR buffer, unincorporated dNTPs, attB primers, and any attB primer-dimers. Primers and primer-dimers can recombine efficiently with the Donor vector in the BP reaction and may increase background after transformation into E. coli, whereas leftover PCR buffer may inhibit the BP reaction. Standard PCR product purification protocols using phenol/chloroform extraction followed by ammonium acetate and ethanol or isopropanol precipitation are not recommended for purification of the attB-PCR product as these protocols generally have exclusion limits of less than 100 bp and do not efficiently remove large primer-dimer products. We recommend a PEG purification protocol (see page 17 of the Gateway Technology with Clonase II manual). If you use the above protocol and your attB-PCR product is still not suitably purified, you may further gel-purify the product. We recommend using the PureLink Quick Gel Extraction kit.

I'm trying to propagate my Gateway destination vector and am not seeing any colonies. What should I do?

Check the genotype of the cell strain you are using. Our Gateway destination vectors typically contain a ccdB cassette, which, if uninterrupted, will inhibit E. coli growth. Therefore, un-cloned vectors should be propagated in a ccdB survival cell strain, such as our ccdB Survival 2 T1R competent cells.

Why does my prestained standard give different molecular weights for different types of gels?

Protein gels vary in pH. Each of the proteins in the standard has a dye molecule attached to it, and the charge on these dye molecules can change depending on the pH of the gel. This change in charge will affect the migration of the protein on the gel.

Is the ProQuest Two-Hybrid System suitable for protein-protein interaction studies with membrane proteins?

The ProQuest Two-Hybrid System is not suitable for proteins containing membrane spanning domains. Protein interaction and activation of transcription of the reporter genes depends on the proteins localizing to the nucleus. You can remove membrane-spanning regions or include only cytosolic or extracelluar domains of membrane bound protein in the bait or prey constructs.

Will I have good expression of bait and prey proteins with non-fermentable carbon sources using the ProQuest Two-Hybrid System?

The ProQuest Two-Hybrid System bait and prey expression vectors utilize the ADH1 promoter, which is generally considered to be a strong constitutive promoter. However, expression is repressed as much as 10-fold on non-fermentable carbon sources. Reference: Bartel PL (1996) Nat Genet 12:72-77.

Does the ProQuest Two-Hybrid System yeast strain, MaV203 have slow growth compared to other commonly used laboratory Saccharomyces cerevisiae strains?

To avoid interference of endogenous GAL4 and GAL80 proteins, MaV203 must carry deletions of the GAL4 and GAL80 genes. As a result of deletion of these two genes, MaV203 cells grow more slowly compared to yeast strains containing the wild-type version of these genes. Please note that the growth rate will depend on the type of growth medium used (e.g., YPD versus SC drop-out media).

Are the MaV203 yeast cells that come with the ProQuest Two-Hybrid System ready for transformation?

No, the MaV203 cells are provided as a glycerol stock. Cells from this stock need to be streaked on a YPD plate for growth at 30 degrees C. Resulting colonies can be used to prepare competent cells for transformation as per the ProQuest Two-Hybrid System manual. Alternatively, ready-to-use MaV203 Competent Yeast Cells, Subcloning Scale (Cat. No. 11445-012) or Library Scale (Cat. No. 11281-011) are available for purchase from Thermo Fisher Scientific.

What is the difference between LR Clonase II and LR Clonase II Plus?

LR Clonase II Plus contains an optimized formulation of recombination enzymes for use in MultiSite Gateway LR reactions. LR Clonase and LR Clonase II enzyme mixes are not recommended for MultiSite Gateway LR recombination reactions, but LR Clonase II Plus is compatible with both multi-site and single-site LR recombination reactions.

What is the purpose of the Proteinase K step following a Gateway LR Recombination reaction, and is it critical to the results?

When the LR reaction is complete, the reaction is stopped with Proteinase K and transformed into E. coli resulting in an expression clone containing a gene of interest. A typical LR reaction followed by Proteinase K treatment yields about 35,000 to 150,000 colonies per 20ul reaction. Without the Proteinase K treatment, up to a 10 fold reduction in the number of colonies can be observed. Despite this reduction, there are often still enough colonies containing the gene of interest to proceed with your experiment, so the Proteinase K step can be left out after the LR reaction is complete if necessary.

Can I go directly from a pENTR/D-TOPO reaction into an LR Clonase Reaction without first purifying the DNA?

In most cases, there will not be enough pENTR vector DNA present to go directly from TOPO cloning into an LR reaction. You need between 100-300 ng of pENTR vector for an efficient LR reaction, and miniprep of a colony from the TOPO transformation is necessary to obtain that much DNA. However, if you want to try it, here are some recommendations for attempting to go straight into LR reactions from the TOPO reaction using pENTR/D, or SD TOPO, or pCR8/GW/TOPO vectors:

1. Heat inactivate the topoisomerase after the TOPO cloning reaction by incubating the reaction at 85 degrees C for 15 minutes.
2. Use the entire reaction (6 µL) in the LR clonase reaction. No purification steps are necessary.
3. Divide the completed LR reaction into 4 tubes and carry out transformations with each tube. You cannot transform entire 20 µL reaction in one transformation, and we have not tried ethanol precipitation and then a single transformation.

When attempting this protocol, we observed very low efficiencies (~10 colonies/plate). So just be aware that while technically possible, going directly into an LR reaction from a TOPO reaction is very inefficient and will result in a very low colony number, if any at all.

Can N-terminal or C-terminal tags be attached to a Gateway Entry clone?

To have an N-terminal tag, the gene of interest must be in the correct reading frame when using non-TOPO adapted Gateway entry vectors. All TOPO adapted Gateway Entry vectors will automatically put the insert into the correct reading frame, and to add the N-terminal tag you simply recombine with a destination vector that has N-terminal tag.

To attach a C-terminal tag to your gene of interest, the insert must lack its stop codon, and be in the correct reading frame for compatibility with our C-terminal tagged destination vectors. Again, TOPO adapted Gateway Entry vectors will automatically put the insert into the correct reading frame. If you do not want the C-terminal tag to be expressed, simply include a stop codon at the end of the insert that is in frame with the initial ATG.

Generally, you need to choose a destination vector before you design and clone your insert into the Entry vector. This will determine whether you need to include an initiating ATG or stop codon with your insert.

Can I use E. coli containing an F' plasmid, such as Top 10F', to propagate a vector with the ccdB gene?

While the F' plasmid does contain the ccdA gene that can inhibit or reduce the toxicity of the ccdB gene product, the ccdA expression level is likely to be too low, or inhibition may not be complete, and the bacteria would still be exposed to the ccdB gene product and thus not grow. Therefore, bacterial strains containing the F' plasmid are not recommended as hosts for propagation of ccdB containing vectors.

For propagation of Gateway vectors containing ccdB, we recommend the One Shot ccdB Survival 2 T1R Competent Cells (A10460), which were specifically designed for that purpose. However, please note that these cells are not validated for propagation of other ccdB-containing vectors like the older pZErO plasmids, and in most cases they are not expected to work due to very high levels of ccdB protein expressed in those vectors.

What are some of the common types of auxotrophic markers in yeast?

The following are commonly employed auxotrophic markers:

1) his3Δ1: Histidine requiring strain (from gene disruption) with a deletion in locus 1. The his3 denotes the disruption of the HIS3 gene. The Δ1 is a deletion that has been engineered to decrease the recombination between the incoming plasmid DNA and the chromosomal site.
2) leu2: Leucine requiring strain due to the disruption of the LEU2 gene.
3) trp1-289: Tryptophan requiring strain, developed from gene disruption and a further point mutation to decrease the recombination between the incoming plasmid DNA and the chromosomal site.
4) ura3-52: Uracil requiring.

For more detail on types and methods of gene disruption in yeast refer to METHODS IN ENZYMOLOGY Vol. 194.

Is there an alternative to the liquid nitrogen method for lysing of yeast colonies/patches for a filter-lift assay?

Yes, here is a protocol for Chloroform Lysis:
1. In a ventilation hood, place 3 ml of chloroform on the lid of the plate (agar side up).
2. Let sit 5 mins at room temperature. The chloroform fumes will rise and lyse the cells.
3. Carefully separate the lid from the rest of the plate. The chloroform fumes will damage the plate and make the rim of the lid "gooey"
4. Place the filter over the colonies and proceed with your assay.

What is the purpose of 3-aminotriazole (3-AT) in the ProQuest Two-Hybrid System?

3-AT is a toxic histidine precursor that is accumulated in cells lacking the HIS3 gene product. Since the his3 mutation is leaky, 3-AT is used to reduce the background growth of his3 cells. The amount of 3-AT used in plates typically ranges from 10 mM to 100 mM. Some investigators have reported using up to 400 mM 3-AT. To determine the appropriate concentration, you should perform a titration.

Can an attB-PCR product be cloned directly into an expression (Gateway Destination) vector?

No, not directly. The attB-PCR product must first be cloned, via a BP Clonase reaction, into a pDONR vector which creates an "Entry Clone" with attL sites. This clone can then be recombined, via an LR Clonase reaction, with a Destination vector containing attR sites. However, It is possible to perform both of these reactions in one step using the "One-Tube Protocol" described in the manual entitled "Gateway Technology with Clonase II".

Can Gateway technology be used to express two proteins from the same vector?

Yes, this can be done using the Multisite Gateway Technology. MultiSite Gateway Pro Technology enables you to efficiently and conveniently assemble multiple DNA fragments - including genes of interest, promoters, and IRES sequences - in the desired order and orientation into a Gateway Expression vector. Using specifically designed att sites for recombinational cloning, you can clone two, three, or four DNA fragments into any Gateway Destination vector containing attR1 and attR2 sites. The resulting expression clone is ready for downstream expression and analysis applications.

What is the efficiency of recombination in the Gateway system?

For the BP reaction, approximately 5-10% of the starting material is converted into product. For the LR reaction, approximately 30% of the starting material is converted into product.

Are there common restriction sites that can be used to excise a gene out of a Gateway plasmid?

The core region of the att sites contains the recognition sequence for the restriction enzyme BsrGI. Provided there are no BsrGI sites in the insert, this enzyme can be used to excise the full gene from most Gateway plasmids. The BsrGI recognition site is 5'-TGTACA and is found in both att sites flanking the insertion site.

If a different restriction site is desired, the appropriate sequence should be incorporated into your insert by PCR.

Do I have to synthesize new attB primers (29 base attB primer + my specific sequence primer) each time I want to make an attB PCR product, or do you have truncated attB primers that work together with adapter attB primers to get a complete attB sequence?

We do have an alternative method called the "attB Adapter PCR" Protocol in which you make your gene specific primer with only 12 additional attB bases and use attB universal adapter primers. This protocol allows for shorter primers to amplify attB-PCR products by utilizing four primers instead of the usual two in a PCR reaction. You can find the sequence of these primers in the protocol on page 45 of the "Gateway Technology with Clonase II" manual.

There is a protocol in which all 4 primers mentioned above are in a single PCR reaction. You can find this protocol at in the following article: Quest vol. 1, Issue 2, 2004. https://www.thermofisher.com/us/en/home/references/newsletters-and-journals/quest-archive.reg.in.html. The best ratio of the first gene-specific and the second attB primers was 1:10.

Do you have recommended sequencing primers for pDONR201?

We do not offer pre-made primers, but we can recommend the following sequences that can be ordered as custom primers for sequencing of pDONR201:
Forward primer, proximal to attL1: 5'- TCGCGTTAACGCTAGCATGGATCTC
Reverse primer, proximal to attL2: 5'-GTAACATCAGAGATTTTGAGACAC

Can you please list some references for Gateway Cloning Technology?

1. Yeast two-hybrid protein-protein interaction studies Walhout AJ, Sordella R, Lu X, Hartley JL, Temple GF, Brasch MA, Thierry-Mieg N, Vidal M.

2. Protein Interaction Mapping in C. elegans Using Proteins Involved in Vulval Development. Science Jan 7th 2000; 287(5450), 116-122 Davy, A. et al.

3. A protein-protein interaction map of the Caenorhabditis elegans 26S proteosome. EMBO Reports (2001) 2 (9), p. 821-828. Walhout, A.J.M. and Vidal, M. (2001).

4. High-throughput Yeast Two-Hybrid Assays for Large-Scale Protein Interaction mapping. Methods: A Companion to Methods in Enzymology 24(3), pp.297-306

5. Large Scale Analysis of Protein Complexes Gavin, AC et al. Functional Organization of the Yeast Proteome by Systematic Analysis of Protein Complexes. Nature Jan 10th 2002, 415, p. 141-147.

6. Systematic subcellular localisation of proteins Simpson, J.C., Wellenreuther, R., Poustka, A., Pepperkok, R. and Wiemann, S.

7. Systematic subcellular localization of novel proteins identified by large-scale cDNA sequencing. EMBO Reports (2000) 1(3), pp. 287-292.

8. Protein-over expression and crystallography Evdokimov, A.G., Anderson, D.E., Routzahn, K.M. & Waugh, D.S.

9. Overproduction, purification, crystallization and preliminary X-ray diffraction analysis of YopM, an essential virulence factor extruded by the plague bacterium Yersinia pestis. Acta Crystallography (2000) D56, 1676-1679.

10. Evdokimov, et al. Structure of the N-terminal domain of Yersinia pestis YopH at 2.0 A resolution. Acta Crystallographica D57, 793-799 (2001).

11. Lao, G. et al. Overexpression of Trehalose Synthase and Accumulation of Intracellular Trehalose in 293H and 293FTetR:Hyg Cells. Cryobiology 43(2):106-113 (2001).

12. High-throughput cloning and expression Albertha J. M. Walhout, Gary F. Temple, Michael A. Brasch, James L. Hartley, Monique A. Lorson, Sander Van Den Huevel, and Marc Vidal.

13. Gateway Recombinational Cloning: Application to the Cloning of Large Numbers of Open Reading Frames or ORFeomes. Methods in Enzymology, Vol. 328, 575-592.

14. Wiemann, S. et.al., Toward a Catalog of Human Genes and Proteins: Sequencing and Analysis of 500 Novel Complete Protein Coding Human cDNAs, Genome Research (March 2001) Vol. 11, Issue 3, pp.422-435

15. Reviewed in NATURE: Free Access to cDNA provides impetus to gene function work. 15 march 2001, p. 289. Generating directional cDNA libraries using recombination

16. Osamu Ohara and Gary F. Temple. Directional cDNA library construction assisted by the in vitro recombination reaction. Nucleic Acids Research 2001, Vol. 29, no. 4. RNA interference (RNAi)

17. Varsha Wesley, S. et al. Construct design for efficient, effective and highthroughput gene silencing in plants. The Plant Journal 27(6), 581-590 (2001). Generation of retroviral constructs

18. Loftus S K et al. Generation of RCAS vectors useful for functional genomic analyses. DNA Res 31;8(5):221 (2001).

19. James L. Hartley, Gary F. Temple and Michael A. Brasch. DNA Cloning Using In Vitro Site-Specific Recombination. Genome Research (2000) 10(11), pp. 1788-1795.

20. Reboul et al. Open-reading frame sequence tags (OSTs) support the existence of at least 17,300 genes in C. elegans. Nature Genetics 27(3):332-226 (2001).

21. Kneidinger, B. et al. Identification of two GDP-6-deoxy-D-lyxo-4-hexulose reductase synthesizing GDP-D-rhamnose in Aneurinibacillus thermoaerophilus L420-91T*. JBC 276(8) (2001).

What do attL1 and attL2 sites look like after recombination between attB and attP sites?

The attP1 sequence (pDONR) is:
AATAATGATT TTATTTTGAC TGATAGTGAC CTGTTCGTTG CAACAAATTG ATGAGCAATGCTTTTTTAT AATGCCAACT TTGTACAAAA AAGC[TGAACG AGAAACGTAA AATGATATAA ATATCAATAT ATTAAATTAG ATTTTGCATA AAAAACAGACTA CATAATACTG TAAAACACAA CATATCCAGT CACTATGAAT CAACTACTTA GATGGTATTA GTGACCTGTA]

The region within brackets is where the site is "cut" and replaced by the attB1-fragment sequence to make an attL1 site. The sequence GTACAAA is the overlap sequence present in all att1 sites and is always "cut" right before the first G.

The overlap sequence in attP2 sites is CTTGTAC and cut before C. This is attP2:
ACAGGTCACT AATACCATCT AAGTAGTTGA TTCATAGTGA CTGGATATGT TGTGTTTTAC AGTATTATGT AGTCTGTTTT TTATGCAAAA TCTAATTTAA TATATTGATA TTTATATCAT TTTACGTTTC TCGTTCAGCT TTCTTGTACA AAGTTGGCAT TATAAGAAAG CATTGCTTAT AATTTGTTG CAACGAACAG GTCACTATCA GTCAAAATAA AATCATTATT

So, attL1 (Entry Clone) should be:
A ATAATGATTT TATTTTGACT GATAGTGACC TGTTCGTTGC AACAAATTGA TGAGCAATGC TTTTTTATAA TGCCAACT TT G TAC AAA AAA GC[A GGC T]NN NNN

attL2 (Entry Clone) should be:
NNN N[AC C]CA GCT TT CTTGTACA AAGTTGGCAT TATAAGAAAG CATTGCTTAT CAATTTGTTG CAACGAACAG GTCACTATCA GTCAAAATAA AATCATTATT

The sequence in brackets comes from attB, and N is your gene-specific sequence.

Note: When creating an Entry Clone through the BP reaction and a PCR product, the vector backbone is not the same as Gateway Entry vectors. The backbone in the case of PCR BP cloning is pDONR201.

How large can PCR fragments be and still be cloned into a Gateway Entry vector?

There is no size restriction on the PCR fragments if they are cloned into a pDONR vector. The upper limit for efficient cloning into a TOPO adapted Gateway Entry vector is approximately 5 kb. A Gateway recombination reaction can occur between DNA fragments that are as large as 150 kb.

What is the influence of the attB sequence on protein function, solubility, folding, and expression?

Destination vectors that contain N-terminal fusion partners will express proteins that contain amino acids contributed from the attB1 site, which is 25 bases long. This means that in addition to any tag (6x His and/or antibody epitope tag), the N-terminus of an expressed protein will contain an additional 9 amino acids from the attB1 sequence - the typical amino acid sequence is Thr-Ser-Leu-Tyr-Lys-Lys-Ala-Gly-nnn, where nnn will depend on the codon sequence of the insert.

Effects on protein function: A researcher (Simpson et al. EMBO Reports 11(31):287-292, 2000) demonstrated that GFP fusions (N- terminal and C-terminal) localized to the proper intracellular compartment. The expression constructs were generated using Gateway cloning, so the recombinant protein contained the attB1 or attB2 amino acid sequence. The localization function of the cloned recombinant proteins was preserved.

Effects on expression: We have seen no effect of the attB sites on expression levels in E. coli, insect and mammalian cells. The gus gene was cloned into bacterial expression vectors (for native and N-terminal fusion protein expression) using standard cloning techniques and expressed in bacteria. Gus was also cloned into Gateway Destination vectors (for native and N-terminal fusion expression) and expressed. When protein expression is compared, there was no difference in the amount of protein produced. This demonstrates that for this particular case, the attB sites do not interfere with transcription or translation.

Effects on solubility: A researcher at the NCI has shown that Maltose Binding Protein fusions constructed with Gateway Cloning were soluble. The fusion proteins expressed had the attB amino acid sequence between the Maltose Binding Protein and the cloned protein. It is possible that some proteins containing the attB sequence could remain insoluble when expressed in E.coli.

Effects on folding: Two Hybrids screens show the same interacters identified with and without the attB sequence. Presumably correct protein folding would be required for protein-protein interactions to take place. It is possible that some proteins containing the attB sequence may not fold correctly.

Must PCR conditions be changed once the original PCR primers have attB sequence added to them?

Since the attB sequences are on the 5' end of oligos, they will not anneal to the target template in the first round of PCR. Sometimes the PCR product is more specific with the attB primers, probably due to the longer annealing sequence (all of attB plus gene specific sequence) after the first round of amplification. Generally there is no need to change PCR reaction conditions when primers have the additional attB sequence

Can PCR primers be tailed directly with attL sites for direct recombination into the destination vector?

No, this is not really feasible due to the fact that the attL sequence is approximately 100 bp, which is too long for efficient oligo synthesis. Our own maximum sequence length for ordering custom primers is 100 nucleotides. In contrast, the attB sequences are only 25 bp long, which is a very reasonable length for adding onto the 5' end of gene-specific PCR primers.

Where can I get Gateway vector sequences and maps?

Vector information can be found in the product manuals or directly on our web site by entering the catalog number of the product in the search box. The vector map, cloning site diagram, and sequence information will be linked to the product page.

From where does Gateway get its lambda nomenclature, and is it consistent with textbook nomenclature for lambda recombination?

The Gateway nomenclature is consistent with lambda nomenclature, but we use numbers to differentiate between modified versions of the att sites (attB1, attB2, attP1, attP2, and so on). We have introduced mutations in the att sites to provide specificity and directionality to the recombination reaction. For example, attB1 will only recombine with attP1 and not with attP2.

What is the first step in an experiment with the Gateway system?

The first step is to create an Entry clone for your gene of interest. We have 3 options to do this: The first is by BP recombination reaction using the PCR Cloning System with Gateway Technology. This is recommended for cloning large (>5 kb) PCR products. We also have Gateway compatible TOPO Cloning vectors such as pCR8/GW/TOPO and pENTR/D-TOPO. The final option is to use restriction enzymes to clone into a pENTR Dual Selection vector.

What are the prerequisites for Gateway cloning and expression?

The gene of interest must be flanked by the appropriate att sites, either attL (100 bp) in an Entry clone or attB (25 bp) in a PCR product. For Entry clones, everything between the attL sites will be shuttled into the Gateway destination vector containing attR sites, and a PCR product flanked by attB sites must be shuttled into an attP-containing donor vector such as pDONR221.

The location of translation initiation sites, stop codons, or fusion tags for expression must be considered in your initial cloning design. For example, if your destination vector contains an N-terminal tag but does not have a C-terminal tag, the vector should already contain the appropriate translation start site but the stop codon should be included in your insert.

Will increasing the Gateway cloning reaction time improve recombination efficiency?

Yes, increasing the incubation time from 1 hour to 4 hours will generally increase colony numbers 2-3 fold. An overnight incubation at room temperature will typically increase colony yield by 5-10 fold.

How many times can I thaw BP Clonase II and LR Clonase II?

BP Clonase II and LR Clonase II can be freeze/thawed at least 10 times without significant loss of activity. However, you may still want to aliquot the enzymes to keep freeze/thaw variability to a minimum.

These enzymes are more stable than the original BP and LR Clonase and can be stored at -20 degrees C for 6 months.

How clean must my DNA be to use in a Gateway cloning reaction?

Mini-prep (alkaline lysis) DNA preparations work well in Gateway cloning reactions. It is important that the procedure remove contaminating RNA for accurate quantification. Plasmid DNA purified with our S.N.A.P. nucleic acid purification kits, ChargeSwitch kits, or PureLink kits are recommended.

How would you incorporate a leader sequence for secretion into an entry vector?

A simple way to express a protein with a leader sequence is to have the leader sequence encoded in the destination vector. The other option is to have the leader sequence subcloned into the entry vector using restriction enzymes, or incorporate the leader sequence into the forward PCR primer when cloning a PCR product into the entry vector. Please see Esposito et al. (2005), Prot. Exp. & Purif. 40, 424-428 for an example of how a partial leader sequence for secretion was incorporated into an entry vector.

Where is the ATG relative to the 5' attB site in a Gateway expression clone?

This depends on whether you are expressing a fusion or a native protein in the Gateway destination vector. For an N-terminal fusion protein the ATG will be given by the destination vector and it will be upstream of the attB1 site. For a C-terminal fusion protein or a native protein, the ATG should be provided by your gene of interest, and it will be downstream of the attB1 site.

Are the Gateway attB1 and attB2 sites the same as the attB site used for recombination into E. coli by bacteriophage lambda?

The Gateway attB sites are derived from the bacteriophage lambda site-specific recombination, but are modified to remove stop codons and reduce secondary structure. The core regions have also been modified for specificity (i.e., attB1 will recombine with attP1 but not with attP2).

Will Gateway att sites affect the expression of my protein?

Expression experiments have shown that the extra amino acids contributed by the attB site to a fusion protein will most likely have no effect on protein expression levels or stability. In addition, they do not appear to have any effect on two-hybrid interactions in yeast. However, as is true with the addition of any extra sequences that result from tags, the possible effects will be protein-dependent.

Can the attB primers anneal in a non-specific manner?

No, attB primers are highly specific under standard PCR conditions. We have amplified from RNA (RT-PCR), cDNA libraries, genomic DNA, and plasmid templates without any specificity problems.

What is the smallest fragment that can be used in a Gateway reaction?

The smallest size we have recombined is a 70 bp piece of DNA located between the att sites. Very small pieces are difficult to clone since they negatively influence the topology of the recombination reaction.

Are there any limitations on the insert length in Gateway cloning?

There is no theoretical size limitation. PCR products between 100 bp and 11 Kb have been readily cloned into a pDONR Gateway vector. Other DNA pieces as large as 150 kb with att sites will successfully recombine with a Gateway-compatible vector. Overnight incubation is recommended for large inserts.

What primer purity should be used for adding attB sites to my PCR product?

Standard desalted purity is generally sufficient for creating attB primers. We examined HPLC-purified oligos for Gateway cloning (about 50 bp long) and found only about a 2-fold increase in colony number over standard desalted primers. If too few colonies are obtained, you may try to increase the amount of PCR product used and/or incubate the BP reaction overnight.

I sequenced one of your vectors after PCR amplification and observed a difference from what is provided online (or in the manual). Should I be concerned?

Our vectors have not been completely sequenced. Your sequence data may differ when compared to what is provided. Known mutations that do not affect the function of the vector are annotated in public databases.

Are your vectors routinely sequenced?

No, our vectors are not routinely sequenced. Quality control and release criteria utilize other methods.

How was the reference sequence for your vectors created?

Sequences provided for our vectors have been compiled from information in sequence databases, published sequences, and other sources.

I am using your ProQuest Two-Hybrid System and am at the step of isolating the prey plasmid. I am not getting enough E. coli transformants. What should I do?

Here are possible causes and solutions:

- E. coli not sufficiently competent: Use ElectroMAX DH10B cells for library.
- Too much DNA used: Use only 1 µl of DNA. Inhibitory compounds may reduce transformation efficiencies.
- Incorrect selection or concentration: Select for plasmid on LB+ampicillin (100 µg/mL).
- Alternative yeast DNA preparation procedure used: Use the method described on page 45 of the manual. Other procedures designed for high-copy-number vectors may not work with the ARS/CEN based vectors used here.
- DNA suspended in incorrect buffer: Electroporation is sensitive to ionic strength. Suspend DNA pellet in TE.

I am performing a ProQuest Two-Hybrid forward screen and am getting high background on SC-Leu-Trp-His+3ST plates. What is the issue?

Here are possible causes and solutions:

- 3AT concentration too low: Retest bait on various concentrations of 3AT.
- Plates made incorrectly: Review Recipes on page 75 of the manual (https://tools.thermofisher.com/content/sfs/manuals/proquest2hybrid_man.pdf).
- Improper replica cleaning: Review Appendix on page 85 of the manual (https://tools.thermofisher.com/content/sfs/manuals/proquest2hybrid_man.pdf). Immediately after replica cleaning, plate should contain no remaining visible cells (although a faint haze may be present on 3AT transformation plates).
- Improper incubation times: Do not incubate plates longer than 60 hours. Colonies arising after 60 hours are not likely to be of interest.

I performed a ProQuest Two-Hybrid forward screen and did not obtain any transformants (candidate interactors) on SC-Leu-Trp-His+3AT plates. Can you help me troubleshoot?

Here are possible causes and solutions:

- Gene of interest not in frame with GAL4 DNA Binding Domain encoding sequence: Sequence the DBD/test DNA junction.
- Poor quality cDNA library: Determine the percent of vectors containing inserts and their average size.
- Inadequate amount of cDNA library: Confirm concentration of library.
- Test DNA cloned into pDEST 32 lacks or masks a domain required for protein-protein interaction: Clone and test alternative segments of the test DNA (bait).
- cDNA library used does not contain proteins that interact with test protein X: Screen a cDNA library from an alternative tissue, developmental time point, or organism; Determine whether the bait protein is expressed in the library.
- Prey that interacts with bait may be toxic, unstable or require posttranslational modification: Some posttranslational modifications cannot be accomplished in yeast; Make sure a cDNA library is constructed in pDEST 22 or pEXP-AD502 and not in other high-copy-number AD-vectors.
- Bait may be toxic, unstable or require post-translational modification: Some posttranslational modifications cannot be accomplished in yeast; Subclone segments of bait into pDEST 32 and retest.

I have your ProQuest Two-Hybrid System and I am seeing growth of MaV203 transformed with bait and pDEST22 on all concentrations of 3AT. What is the problem?

Here are possible causes and solutions:

- Bait self-activates: Subclone segments of bait into pDEST 32 and retest.
- Incorrectly prepared 3AT plates: Review Appendix on page 75 of the manual (https://tools.thermofisher.com/content/sfs/manuals/proquest2hybrid_man.pdf). Confirm that all stock solutions were fresh and prepared correctly. Confirm that the calculation for amount of 3AT addition was correct.
- Improper replica plating or replica cleaning: Review Appendix on page 85 of the manual (https://tools.thermofisher.com/content/sfs/manuals/proquest2hybrid_man.pdf). Immediately after replica cleaning, plate should contain no remaining visible cells (although a faint haze may be present on 3AT transformation plates).
- Incorrect incubation times: Incubate plates no longer than 60 hours (40-44 hours is usually best). Colonies arising after 60 hours are not likely to be of interest.

With the ProQuest Two-Hybrid System, my transformants fail to grow on any of the SC-Leu-Trp-His + 3AT plates? What is going on?

Here are possible causes and solutions:

- Incorrectly prepared 3AT plates: Review Appendix on page 75 of the manual (https://tools.thermofisher.com/content/sfs/manuals/proquest2hybrid_man.pdf). Confirm that all stock solutions were fresh and prepared correctly. Confirm that the calculation for amount of 3AT addition was correct.
- Strains being tested do not contain bait and prey: Confirm growth on SC-Leu-Trp plates.
- Uneven replica plating: When replica plating, maintain an even pressure across the entire surface of the master and selection plates. Uneven pressure can result in the failure of cells to transfer.

I am using your ProQuest Two-Hybrid System. My yeast controls 2, 3, and 8 failed to grow on SC-Leu-Trp-His + 3AT plates. Can you help me troubleshoot?

Here are possible causes and solutions:

- Incorrectly prepared 3AT plates: Review Appendix on page 75 of the manual (https://tools.thermofisher.com/content/sfs/manuals/proquest2hybrid_man.pdf). Confirm that all stock solutions were fresh and prepared correctly. Confirm that the calculation for amount of 3AT addition was correct.
- Controls are too old or were mixed up: Return to the original DNA stocks provided, retransform on SC-Leu-Trp, and use fresh colonies.
- Uneven replica plating: When replica plating, maintain an even pressure across the entire surface of the master and selection plates. Uneven pressure can result in the failure of cells to transfer.

I used your ProQuest Two-Hybrid System and my candidate clones failed to reproduce the reporter gene activation observed in the original screen. What is the issue?

Here are possible causes and solutions:

- Candidate clones were false positives: Candidate clones could have been mutants of bait that self-activate; See page 50 of the manual (https://tools.thermofisher.com/content/sfs/manuals/proquest2hybrid_man.pdf) for additional information on false positives.
- Co-transformed pDEST 32 instead of bait plasmid: Retransform MaV203 with bait and prey plasmid.
- Muliple prey clones in the original 3ATR transformants: Examine more ampicillin E. coli transformants for additional prey clones. Test each by reintroduction.

I have your ProQuest Two-Hybrid System. I transformed MaV203 competent yeast cells with DNA isolated from E. coli and did not get any transformants. What could have happened?

Here are possible causes and solutions:

- Failure to add both bait and prey plasmids during transformation: Use bait and prey plasmids simultaneously in co-transformation procedures.
- Incorrect selection plates: Plate co-transformations on SC-Leu-Trp plates.

I am using your ProQuest Two-Hybrid System and the yeast control 4-7 shows growth on SC-Leu-Trp-His + 3AT plates. How is this possible?

Here are possible causes and solutions:

- Plates not replica cleaned: Replica clean immediately after replica plating, and again after 24 hours incubation.
- Inadequate replica cleaning: Review Appendix on page 85 of the manual (https://tools.thermofisher.com/content/sfs/manuals/proquest2hybrid_man.pdf). Immediately after replica cleaning, plate should contain no remaining visible cells.
- Too many cells transferred during replica plating: Review Appendix on page 85 of the manual (https://tools.thermofisher.com/content/sfs/manuals/proquest2hybrid_man.pdf). Transfer a minimal number of cells.
- Incorrectly prepared 3AT plates: Review Appendix on page 75 of the manual (https://tools.thermofisher.com/content/sfs/manuals/proquest2hybrid_man.pdf); Confirm that all stock solutions were fresh and prepared correctly; Confirm that the calculation for amount of 3AT addition was correct.
- Incorrect incubation times: Incubate plates no longer than 60 hours (40-44 hours is usually best). Colonies arising after 60 hours are not likely to be of interest.

I used your ProQuest Two-Hybrid System and got very few to no colonies when I performed the sample reaction, but the transformation control did result in colonies. What is the problem?

Here are possible causes and solutions:

- Incorrect antibiotic used to select for transformants: Select for transformants on LB agar plates containing 10 µg/mL ampicillin (for prey plasmids).
- Didn't use the suggested LR Clonase II enzyme mix or LR Clonase II enzyme mix was inactive: Make sure to store the LR Clonase II enzyme mix at -20 degrees C or -80 degrees C; Do not freeze/thaw the LR Clonase II enzyme mix more than 10 times; Use the recommended amount of LR Clonase II enzyme mix; Test another aliquot of the LR Clonase II enzyme mix.
- Not enough transformation mixture plated: Increase the amount of E.coli plated.

Can I perform yeast two-hybrid analysis by mating instead of transformation with two plasmids?

This can definitely be done especially if looking at multiple combinations of interactions. The 2 yeast strains used will have to be of different mating types (MATa, and MATalpha). Markers on the two plasmids will have to be used in selection of diploids. MaV103 can be used as mating partner for this purpose. MaV103 has the same genotype as MaV203 except they are MATa. MaV103 with bait vector will be LEU2+ and MaV203 with prey vector will be TRP1+. Therefore diploids can be selected on SC-leu-trp plates. For further details on this method, refer to Nature Genetics (1996), 12: 72-77; Vidal, M et al. (1996) PNAS 93:10315.

What is the purpose of 3-aminotriazole (3-AT) in the ProQuest Two-Hybrid System with Gateway Technology?

3-AT is a toxic histidine precursor that is accumulated in cells lacking the HIS3 gene product. Since the his3 mutation is leaky, 3-AT is used to reduce the background growth of his3 cells. The amount of 3-AT used in plates typically ranges from 10 mM to 100 mM. Some investigators have reported using up to 400 mM 3-AT. To determine the appropriate concentration, you should perform a titration.

Is the ProQuest Two-Hybrid System with Gateway Technology suitable for protein-protein interaction studies with membrane proteins?

The ProQuest Two-Hybrid System is not suitable for proteins containing membrane spanning domains. Protein interaction and activation of transcription of the reporter genes depends on the proteins localizing to the nucleus. You can remove membrane-spanning regions or include only cytosolic or extracelluar domains of membrane bound protein in the bait or prey constructs.

Will I have good expression of bait and prey proteins with non-fermentable carbon sources using the ProQuest Two-Hybrid System with Gateway Technology?

The ProQuest Two-Hybrid System bait and prey expression vectors utilize the ADH1 promoter, which is generally considered to be a strong constitutive promoter. However, expression is repressed as much as 10-fold on non-fermentable carbon sources (Bartel PL (1996) Nat Genet 12:72-77).

What is the recommended protocol for preparation of competent yeast for large-scale transformation with bait and plasmid-library in the ProQuest system?

(1) Suspend several colonies of MaV203 in 50 µL autoclaved, distilled water in a microcentrifuge tube and spread it onto the center of a 10-cm YPAD plate using an autoclaved loop or toothpick. Repeat procedure for a second YPAD plate. Incubate both plates for 18-24 h at 30 degrees C. 

(2) Scrape and completely suspend the cells (by brief vortexing and pipetting up and down) in 10 mL autoclaved, distilled water. Add a sufficient volume of this cell suspension to two 1-L flasks each containing 500 mL liquid YPAD medium to give an OD600 of ~0.1. Reserve approximately 10 mL YPAD medium to use as a blank in the spectrophotometer. 
Note: Perform serial 1:10 dilutions in water of the 10-mL cell suspension then determine the OD600 of each dilution to allow an estimate of cell suspension required to produce the desired OD of 0.1. Appropriate cell densities require that the measured OD be <1.0. Verify that the OD is ~0.1 after inoculation. Use plastic cuvettes for all OD600 measurements. 

(3) Shake (~250 rpm) at 30 degrees C until the OD600 reaches ~0.4 (usually ~5 h). Read the OD. 

(4) Prepare fresh: 
225 mL 1X TE/LiAc by combining 22.5 mL 10X TE, 22.5 10X LiAc, and 180 mL autoclaved H2O. 
30 mL PEG/LiAc by combining 3 mL 10X TE, 3 mL 10X LiAc, and 24 mL 50% PEG-3350. 
200 µL carrier DNA by boiling sonicated herring sperm DNA or sonicated salmon sperm DNA (10 mg/mL) for 5 min and placing on ice until use. 

(5) Split each 500 mL of yeast cells into two conical 250-mL tubes and centrifuge at 3,000 x g for 5 min at room temperature. 

(6) Pour off the supernatants and gently suspend each pellet by pipetting up and down in 100 mL autoclaved, distilled water at room temperature. 

(7) Centrifuge at 3,000 x g for 5 min at room temperature. Pour the supernatant off of the centrifuged cells and suspend each cell pellet in 50 mL 1X TE/LiAc solution. 

(8) Centrifuge at 3,000 x g for 5 min at room temperature. Carefully pour off the supernatants and suspend each cell pellet in a final volume of 1 mL 1X TE/LiAc solution and pool all suspensions for a total of 4 mL. 

(9) Perform 30 transformations. Combine 4 mL of cells, 200 µL freshly boiled carrier DNA and 150 µg (~1 µg/µL) bait plasmid DNA and 150 µg (~1 µg/µL) plasmid-library plasmid DNA. Mix gently by pipetting up and down. Add 24 mL PEG/LiAc solution and mix gently, but completely. Aliquot into 30 autoclaved microcentrifuge tubes of 950 µL each.

(10) Incubate for 30 min in a 30 degrees C water bath. 

(11) Heat shock for 15 min in a 42 degrees C water bath. 

(12) Centrifuge in a microcentrifuge (6,000 - 8,000 x g) for 20-30 s at room temperature. Carefully remove the supernatant. 

(13) Gently suspend each pellet in 400 µL autoclaved, distilled water by pipetting up and down. 

(14) To estimate the total number of transformants, plate two dilutions of the transformation. Mix 10 µL of transformation with 90 µL autoclaved, distilled water. Plate 100 µL on a 10-cm SC-Leu-Trp plate (1:800 final dilution factor). Mix 10 µL of transformation with 990 µL autoclaved, distilled water. Plate 100 µL on a 10-cm SC-Leu Trp plate (1:8,000 final dilution factor).

Are the MaV203 yeast cells that come with the ProQuest Two-Hybrid System with Gateway Technology ready for transformation?

No, the MaV203 cells are provided as a glycerol stock. Cells from this stock need to be streaked on a YPD plate for growth at 30 degrees C. Resulting colonies can be used to prepare competent cells for transformation as per the ProQuest Two-Hybrid System manual. Alternatively, ready-to-use MaV203 Competent Yeast Cells, Subcloning Scale (Cat. No. 11445-012) or Library Scale (Cat. No. 11281-011) are available for purchase from us.

Does the MaV203 yeast strain have slow growth compared to other commonly used laboratory Saccharomyces cerevisiae strains?

To avoid interference of endogenous GAL4 and GAL80 proteins, MaV203 must carry deletions of the GAL4 and GAL80 genes. As a result of deletion of these two genes, MaV203 cells grow more slowly compared to yeast strains containing the wild-type version of these genes. Note that the growth rate will depend on the type of growth medium used (e.g., YPD versus SC drop-out media).

Can I perform yeast two-hybrid analysis by mating instead of transformation with bait and prey plasmids?

This can definitely be done, especially if looking at multiple combinations of interactions. The two yeast strains used will have to be of different mating types (MATa and MAT alpha). Markers on the bait and prey plasmids will have to be used in selection of the diploids.

What is the genotype of MaV203?

The genotype of MaV203 is as follows:
MaV203 (MATα, leu2-3,112, trp1-901, his3Δ200, ade2-101, gal4Δ, gal80Δ, SPAL10::URA3, GAL1::lacZ, HIS3UAS GAL1::HIS3@LYS2, can1R, cyh2R)
Note: The yeast strain MaV203 is unique to the ProQuest Two-Hybrid System. Other yeast strains used for two-hybrid analysis cannot be substituted.

Which yeast strain do you provide with the ProQuest Two-Hybrid System with Gateway Technology?

The yeast strain provided in the ProQuest Two-Hybrid System is MaV203 that contains the following features:

  • A set of non-reverting auxotrophic mutations: leu2 and trp1 to allow selection for the bait and prey fusion vectors, and his3 for growth upon induction of the reporter gene GAL1::HIS3
  • Deletions of the GAL4 and GAL80 genes encoding GAL4 and its repressor GAL80, respectively. In the absence of GAL80, galactose is not required for activation of GAL4-inducible promoters
  • Three stably integrated single-copy GAL4-inducible reporter genes: SPAL10::URA3 integrated at URA3; HIS3UAS GAL1::HIS3 integrated at LYS2; and GAL1::lacZ integrated at an unknown locus
  • The recessive drug resistance marker cyh2R for plasmid shuffling

What are the components of the Proquest Two-Hybrid System with Gateway Technology?

The ProQuest Two-Hybrid System includes:

- Yeast expression vectors: pDEST32 for generation of the bait plasmid containing the gene of interest in frame with the GAL4 DNA Binding Domain (GAL4 DBD), pDEST22 for generation of the prey plasmid containing the second known gene of interest in frame with the GAL4 Activation Domain (GAL4 AD), and pEXP-AD502 to construct a cDNA or genomic library for identifying proteins (preys) that interact with the fusion protein (bait)
- Reagents for production of the expression clones containing GAL4 DBD and GAL4 AD fusion proteins
- A glycerol stock of yeast strain MaV203, which is the two-hybrid yeast strain used
- Positive and negative controls for the two-hybrid assay

What are the main features of the Proquest Two-Hybrid System with Gateway Technology?

The ProQuest Two-Hybrid System offers a number of features to decrease false positives. They are listed below:

- Uses low-copy-number (ARS/CEN) vectors to control over-expression and increase reproducibility
- Contains three different reporter genes with independent promoters to rapidly weed out false positives
- Uses a reporter gene (URA3) that allows both positive and negative selection, which enables advanced two-hybrid techniques such as reverse two-hybrid
- An extended panel of yeast control vectors to aid in setting up the experiments and evaluate results
- Incorporation of the Gateway Technology to allow rapid and easy generation of bait and prey constructs, and to facilitate down-stream applications

Do you offer a system to detect protein-protein interactions in vivo?

We offer the Proquest Two-Hybrid System with Gateway Technology, which is a genetic method for detecting interactions between proteins in vivo in the yeast Saccharomyces cerevisiae. The ProQuest system can be used to:

  • Test for interaction between two known proteins 
  • Screen a library for novel proteins that specifically interact with a known bait


For Research Use Only. Not for use in diagnostic procedures.

Product Title
Select an issue

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.