Promotional price valid on web orders only. Your contract pricing may differ. Interested in signing up for a dedicated account number?
Learn More
  1. Home
  2. Products
  3. 5000365669

Medchemexpress LLC Rna, (cuagugguccuaaacauuuc) (full-length nucleotide 2'-methoxy modification) | 98.2% | 6569.33 | 20 NMOL
SDP

Supplier:  Medchemexpress LLC 20NMOLHYR00411

Encompass_Preferred

Hsa-miR-203a-3p inhibitors are chemically-modified oligonucleotides that hybridize with mature microRNAs. These inhibitors feature full-length nucleotide 2'-methoxy modification, allowing them to strongly compete with mature microRNAs. This competition prevents the complementary pairing of microRNAs and their target genes, effectively inhibiting microRNA function.

  • Chemically-modified oligonucleotides
  • Full-length nucleotide 2'-methoxy modification
  • Inhibits microRNA function
  • For research use only
  • Molecular weight: 6569.33
  • Purity: 98.21%
  • Available in various sizes, including 20 nmol
  • Recommended storage at -20°C, sealed and away from moisture
  • Appearance as a white to off-white solid

Catalog No. 50-003-65669


May include imposed supplier surcharges.
Add to Cart

Product Title
Select an issue

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.