Promotional price valid on web orders only. Your contract pricing may differ. Interested in signing up for a dedicated account number?
Learn More

Medchemexpress LLC SiRNA Negative Control | RNA, (UUCUCCGAACGUGUCACGUUU), complex with RNA, (ACGUGACACGUUCGGAGAAUU) (1:1) | 1 MG
SDP

Catalog No. 5000374120
Encompass_Preferred

SiRNA Negative Control is a siRNA of 21 nucleotides that can be used as a negative control. It has no homology to most known gene sequences and is suitable for use in human, mouse, and rat cells in vitro. This control serves as an experimental benchmark to verify reliability and act as a standardization reference, making it a common choice in many research articles.

  • SiRNA of 21 nucleotides
  • Can be used as a negative control
  • Has no homology to most known gene sequences
  • Can be used in human, mouse, and rat cells in vitro
  • Serves as an experimental control benchmark
  • Verifies experimental reliability
  • Acts as a standardization reference
  • Commonly used in most research articles

Catalog No. 50-003-74120 Supplier Medchemexpress LLC Supplier No. HY1501501MG
May include imposed supplier surcharges.
Add to Cart
Add to Cart

missing translation for 'validMainframeMsg'

SiRNA Negative Control is a siRNA of 21 nucleotides that can be used as a negative control. It has no homology to most known gene sequences and is suitable for use in human, mouse, and rat cells in vitro. This control serves as an experimental benchmark to verify reliability and act as a standardization reference, making it a common choice in many research articles.

  • SiRNA of 21 nucleotides
  • Can be used as a negative control
  • Has no homology to most known gene sequences
  • Can be used in human, mouse, and rat cells in vitro
  • Serves as an experimental control benchmark
  • Verifies experimental reliability
  • Acts as a standardization reference
  • Commonly used in most research articles

Product Title
Select an issue

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.