Promotional price valid on web orders only. Your contract pricing may differ. Interested in signing up for a dedicated account number?
Learn More
Learn More
Medchemexpress LLC SiRNA Negative Control | RNA, (UUCUCCGAACGUGUCACGUUU), complex with RNA, (ACGUGACACGUUCGGAGAAUU) (1:1) | 1 MG
Supplier: Medchemexpress LLC HY1501501MG
SiRNA Negative Control is a siRNA of 21 nucleotides that can be used as a negative control. It has no homology to most known gene sequences and is suitable for use in human, mouse, and rat cells in vitro. This control serves as an experimental benchmark to verify reliability and act as a standardization reference, making it a common choice in many research articles.
- SiRNA of 21 nucleotides
- Can be used as a negative control
- Has no homology to most known gene sequences
- Can be used in human, mouse, and rat cells in vitro
- Serves as an experimental control benchmark
- Verifies experimental reliability
- Acts as a standardization reference
- Commonly used in most research articles
Product Title
By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.
Spot an opportunity for improvement?