Isoflavonoids
Selleck Chemical LLC Sophoricoside S3776-25mg
Sophoricoside (SOPH) is an isoflavone isolated from Sophora japonica (Leguminosae) with numerous pharmacological effects including anti- inflammatory anti-cancer and immunosuppressive effects
Selleck Chemical LLC Genistin (Genistoside) S2301-50mg
Genistin (Genistoside Genistine Genistein 7-glucoside Genistein glucoside) is an isoflavone found in a number of dietary plants like soy and kudzu Genistin attenuates cellular growth and promotes apoptotic cell death breast cancer cells through modulation of Estrogen Receptor (ER ) signaling pathway
Indofine Chemical Daidzin, 96%, 5 Mg
DAIDZIN 5 MG, Isoflavone, Daidzein-7-O-glucoside, 7-Glucocosyl-4'-hydroxyisoflavone, C21H20O9, MW: 416.37, 96+%, 552-66-9, MFCD00017466
Medchemexpress LLC Inactive ASO (in vivo) sodium | CCTATAGGACTATCCAGGAA | 5 MG
Inactive ASO (in vivo) sodium is an inactive Antisense Oligonucleotide (ASO), typically 20-30 bases long, designed to interfere with or regulate gene expression. This specific ASO serves as a negative control for Tofersen, as it is not targeted in the rodent genome.
- Oligonucleotide molecules
- Interferes with or regulates gene expression
- Not targeted in the rodent genome
- Serves as a negative control for Tofersen
- Features thiophosphate skeleton modification
- Includes MOE modification
- Contains 5' methylcytosine
Cayman Chemical Formononetin 10mg
An isoflavonoid phytoestrogenic compound found in soy-based foods; acts as an agonist of the aryl hydrocarbon receptor (EC50 = 0.13 µM) and has been reported to possess antitumor and antiviral activity
Apexbio Technology LLC ONONIN-20MG
Ononin (CAS No 486-62-4) is a naturally occurring isoflavone glycoside primarily found in various leguminous plants It is a key subject in biomedical research particularly in the fields of oncology cardiology and neuroprotection Ononin exerts its effects by modulating multiple cellular pathways including kinase signaling and oxidative stress mechanisms Its in vitro activity is observed in the nanomolar to low micromolar range indicating a promising pharmacological potential Typical applications involve using various cell models to study its anti-inflammatory and antioxidant properties and animal studies have explored its impact on metabolic and cardiovascular health Additionally ononin serves as a candidate in drug screening for developing novel therapeutics Experimental concentrations typically depend on the specific research design allowing for tailored investigation into its efficacy and safety
Medchemexpress LLC Genistein 7-β-d-glucuronide | 38482-81-4 | MFCD24849233 | 98.8% | 446.36 | C21H18O11 | 5 MG
Genistein 7-β-d-glucuronide is a natural isoflavone glucuronide reported to inhibit tubulogenesis and endothelial migration. It is provided as a research reagent and is characterized by formula C21H18O11 and molecular weight 446.36.
- High purity (98.8%) suitable for analytical and biological studies.
- Stable storage recommendations included for long-term and short-term preservation.
- Available in small milligram quantities for laboratory experiments.
- Suitable for studies of endothelial cell function and tubulogenesis.
- Provided with supplier characterization data for research reproducibility.
