C_101640417_10

SNP ID:

rs76966935

Gene

ARFGAP2 C11orf49 MIR6745 PACSIN3

Gene Name

ADP ribosylation factor GTPase activating protein 2

chromosome 11 open reading frame 49

microRNA 6745

protein kinase C and casein kinase substrate in neurons 3

Set Membership:

-

Chromosome Location:

Chr.11: 47172735 - 47172735 on Build GRCh38

Polymorphism:

T/C, Transition substitution

Context Sequence [VIC/FAM]:

CTCTGGCAGGAAGGGCCCCTTTAGC[T/C]GACAGATACACGGACTCTGGAGGAG

Assay Details

Species:	Human
dbSNP Submissions:	NA
Phenotype:	MIM: 606908 MIM: 606513
Literature Links:	ARFGAP2 PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global C (0.04) (0.96)	Caucasian - Not Available	CEPH (CEU) - Not Available
EAS C (0.12) (0.88)	African American - Not Available	YRI (Yoruba) - Not Available
SAS C (0.01) (0.99)	Chinese - Not Available	CHB (Han Chinese) - Not Available
AFR C (0.00) (1.00)	Japanese - Not Available	JPT (Japanese) - Not Available
EUR C (0.00) (1.00)
AMR C (0.12) (0.88)

ARFGAP2 - ADP ribosylation factor GTPase activating protein 2
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_001242832.1	1328	Intron			NP_001229761.1
NM_032389.4	1328	Intron			NP_115765.2
XM_005253166.1	1328	Silent Mutation	TCA,TCG	S,S 237	XP_005253223.1
XM_005253167.1	1328	Silent Mutation	TCA,TCG	S,S 226	XP_005253224.1
XM_005253168.2	1328	Silent Mutation	TCA,TCG	S,S 212	XP_005253225.1
XM_006718346.1	1328	Intron			XP_006718409.1
XM_011520405.1	1328	Silent Mutation	TCA,TCG	S,S 184	XP_011518707.1
XM_017018413.1	1328	Intron			XP_016873902.1
XM_017018414.1	1328	Intron			XP_016873903.1
XM_017018415.1	1328	Intron			XP_016873904.1

C11orf49 - chromosome 11 open reading frame 49
There are no transcripts associated with this gene.

MIR6745 - microRNA 6745
There are no transcripts associated with this gene.

PACSIN3 - protein kinase C and casein kinase substrate in neurons 3
There are no transcripts associated with this gene.

More Information

Panther Classification:

Molecular Function -

GTPase-activating protein

Gene Ontology Categories:

Process(es)

ER to Golgi vesicle-mediated transport
retrograde vesicle-mediated transport, Golgi to ER
protein transport
positive regulation of GTPase activity

Function(s)

GTPase activator activity
metal ion binding