C_102736240_10

SNP ID:

rs79241392

Gene

C21orf58 PCNT YBEY

Gene Name

chromosome 21 open reading frame 58

pericentrin

ybeY metallopeptidase (putative)

Set Membership:

-

Chromosome Location:

Chr.21: 46315223 - 46315223 on Build GRCh38

Polymorphism:

C/T, Transition substitution

Context Sequence [VIC/FAM]:

ACTCGGATGCATCTTTGGTGAGTGC[C/T]GTGGGAGCAAACCTCCAGGCATCCC

Assay Details

Species:	Human
dbSNP Submissions:	NA
Phenotype:	MIM: 605925
Literature Links:	C21orf58 PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global T (0.02) (0.98)	Caucasian - Not Available	CEPH (CEU) - Not Available
EAS T (0.00) (1.00)	African American - Not Available	YRI (Yoruba) - Not Available
SAS T (0.00) (1.00)	Chinese - Not Available	CHB (Han Chinese) - Not Available
AFR T (0.00) (1.00)	Japanese - Not Available	JPT (Japanese) - Not Available
EUR T (0.07) (0.93)
AMR T (0.03) (0.97)

C21orf58 - chromosome 21 open reading frame 58
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_001286462.1		Intron			NP_001273391.1
NM_001286463.1		Intron			NP_001273392.1
NM_001286476.1		Intron			NP_001273405.1
NM_001286477.1		Intron			NP_001273406.1
NM_058180.4		Intron			NP_478060.2
XM_005261148.4		Intron			XP_005261205.1
XM_006724018.3		Intron			XP_006724081.1
XM_011529619.2		Intron			XP_011527921.1
XM_011529620.2		Intron			XP_011527922.1
XM_011529621.2		Intron			XP_011527923.1
XM_011529623.2		Intron			XP_011527925.1
XM_011529624.2		Intron			XP_011527926.1
XM_011529625.2		Intron			XP_011527927.1
XM_011529626.2		Intron			XP_011527928.1
XM_011529627.2		Intron			XP_011527929.1
XM_011529628.1		Intron			XP_011527930.1
XM_017028388.1		Intron			XP_016883877.1
XM_017028389.1		Intron			XP_016883878.1
XM_017028390.1		Intron			XP_016883879.1
XM_017028391.1		Intron			XP_016883880.1
XM_017028392.1		Intron			XP_016883881.1
XM_017028393.1		Intron			XP_016883882.1

PCNT - pericentrin
There are no transcripts associated with this gene.

YBEY - ybeY metallopeptidase (putative)
There are no transcripts associated with this gene.