C_102736261_10

SNP ID:

rs76328736

Gene

C21orf58 PCNT YBEY

Gene Name

chromosome 21 open reading frame 58

pericentrin

ybeY metallopeptidase (putative)

Set Membership:

-

Chromosome Location:

Chr.21: 46323671 - 46323671 on Build GRCh38

Polymorphism:

C/T, Transition substitution

Context Sequence [VIC/FAM]:

CCCCTGAGATCCACCTCAGCAGCCT[C/T]CTCCGTGGTAGGCCTCAACTTCCCG

Assay Details

Species:	Human
dbSNP Submissions:	NA
Phenotype:	MIM: 605925
Literature Links:	C21orf58 PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global T (0.04) (0.96)	Caucasian - Not Available	CEPH (CEU) - Not Available
EAS T (0.00) (1.00)	African American - Not Available	YRI (Yoruba) - Not Available
SAS T (0.02) (0.98)	Chinese - Not Available	CHB (Han Chinese) - Not Available
AFR T (0.09) (0.91)	Japanese - Not Available	JPT (Japanese) - Not Available
EUR T (0.04) (0.96)
AMR T (0.05) (0.95)

C21orf58 - chromosome 21 open reading frame 58
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_001286462.1	229	Intron			NP_001273391.1
NM_001286463.1	229	Intron			NP_001273392.1
NM_001286476.1	229	UTR 5			NP_001273405.1
NM_001286477.1	229	UTR 5			NP_001273406.1
NM_058180.4	229	UTR 5			NP_478060.2
XM_005261148.4	229	UTR 5			XP_005261205.1
XM_006724018.3	229	UTR 5			XP_006724081.1
XM_011529619.2	229	UTR 5			XP_011527921.1
XM_011529620.2	229	UTR 5			XP_011527922.1
XM_011529621.2	229	UTR 5			XP_011527923.1
XM_011529623.2	229	UTR 5			XP_011527925.1
XM_011529624.2	229	Intron			XP_011527926.1
XM_011529625.2	229	Intron			XP_011527927.1
XM_011529626.2	229	UTR 5			XP_011527928.1
XM_011529627.2	229	UTR 5			XP_011527929.1
XM_011529628.1	229	UTR 5			XP_011527930.1
XM_017028388.1	229	UTR 5			XP_016883877.1
XM_017028389.1	229	UTR 5			XP_016883878.1
XM_017028390.1	229	UTR 5			XP_016883879.1
XM_017028391.1	229	UTR 5			XP_016883880.1
XM_017028392.1	229	Intron			XP_016883881.1
XM_017028393.1	229	Intron			XP_016883882.1

PCNT - pericentrin
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_001315529.1	229	Intron			NP_001302458.1
NM_006031.5	229	Intron			NP_006022.3
XM_005261124.4	229	Intron			XP_005261181.1
XM_011529594.2	229	Intron			XP_011527896.1
XM_017028362.1	229	Intron			XP_016883851.1
XM_017028363.1	229	Intron			XP_016883852.1

YBEY - ybeY metallopeptidase (putative)
There are no transcripts associated with this gene.

More Information

Gene Ontology Categories:

Process(es)

G2/M transition of mitotic cell cycle
microtubule cytoskeleton organization
mitotic spindle organization
cilium assembly
positive regulation of intracellular protein transport

Function(s)

protein binding
calmodulin binding