C_172968356_10

• SNP ID: rs141519128
• Gene: PTPRN2
• Gene Name: protein tyrosine phosphatase, receptor type N2
• Set Membership: -
• Chromosome Location: Chr.7: 158192390 - 158192390 on Build GRCh38
• Polymorphism: A/G, Transition substitution
• Context Sequence [VIC/FAM]:

  CGAGCACGTCTGAGGCTGGGGCCTG[A/G]GACAGGGCCTCCAGGAAGGGCAGGT

Assay Details

Species:	Human
dbSNP Submissions:	NA
Phenotype:	MIM: 601698
Literature Links:	PTPRN2 PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global - Not Available	Caucasian - Not Available	CEPH (CEU) - Not Available
EAS - Not Available	African American - Not Available	YRI (Yoruba) - Not Available
SAS - Not Available	Chinese - Not Available	CHB (Han Chinese) - Not Available
AFR - Not Available	Japanese - Not Available	JPT (Japanese) - Not Available
EUR - Not Available
AMR - Not Available

PTPRN2 - protein tyrosine phosphatase, receptor type N2
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_001308267.1	619	Silent Mutation			NP_001295196.1
NM_001308268.1	619	Silent Mutation			NP_001295197.1
NM_002847.4	619	Silent Mutation			NP_002838.2
NM_130842.3	619	Silent Mutation			NP_570857.2
NM_130843.3	619	Silent Mutation			NP_570858.2
XM_011516446.1	619	Silent Mutation			XP_011514748.1
XM_011516447.2	619	Silent Mutation			XP_011514749.1
XM_011516448.2	619	Silent Mutation			XP_011514750.1
XM_011516449.2	619	Silent Mutation			XP_011514751.1
XM_017012475.1	619	Silent Mutation			XP_016867964.1
XM_017012476.1	619	Silent Mutation			XP_016867965.1

More Information

Panther Classification:

Molecular Function -

protein phosphatase, protein modifying enzyme

Gene Ontology Categories:

Process(es)

protein dephosphorylation
neurotransmitter secretion
negative regulation of GTPase activity
peptidyl-tyrosine dephosphorylation
insulin secretion involved in cellular response to glucose stimulus

Function(s)

transmembrane receptor protein tyrosine phosphatase activity