C_190745227_10

SNP ID:

rs202150278

Gene

NR0B2 NUDC

Gene Name

nuclear receptor subfamily 0 group B member 2

nuclear distribution C, dynein complex regulator

Set Membership:

-

Chromosome Location:

Chr.1: 26913738 - 26913738 on Build GRCh38

Polymorphism:

A/G, Transition substitution

Context Sequence [VIC/FAM]:

GAAGGATGGCAGGTTCCTGAGGAAG[A/G]CCACTGTCTTGGCCAGAACATCCAA

Assay Details

Species:	Human
dbSNP Submissions:	5 submissions
Phenotype:	MIM: 604630 MIM: 610325
Literature Links:	NR0B2 PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global - Not Available	Caucasian - Not Available	CEPH (CEU) - Not Available
EAS - Not Available	African American - Not Available	YRI (Yoruba) - Not Available
SAS - Not Available	Chinese - Not Available	CHB (Han Chinese) - Not Available
AFR - Not Available	Japanese - Not Available	JPT (Japanese) - Not Available
EUR - Not Available
AMR - Not Available

NR0B2 - nuclear receptor subfamily 0 group B member 2
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_021969.2	339	Missense Mutation	GCC,GTC	A,V 68	NP_068804.1
XM_011542297.2	339	Missense Mutation	GCC,GTC	A,V 68	XP_011540599.1

NUDC - nuclear distribution C, dynein complex regulator
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_006600.3	339	Intron			NP_006591.1
XM_011540529.1	339	Intron			XP_011538831.1
XM_011540530.1	339	Intron			XP_011538832.1
XM_017000094.1	339	Intron			XP_016855583.1
XM_017000095.1	339	Intron			XP_016855584.1
XM_017000096.1	339	Intron			XP_016855585.1

More Information

Panther Classification:

Molecular Function -

C4 zinc finger nuclear receptor, DNA-binding transcription factor, zinc finger transcription factor, gene-specific transcriptional regulator, microtubule or microtubule-binding cytoskeletal protein

Gene Ontology Categories:

Process(es)

negative regulation of transcription from RNA polymerase II promoter
transcription initiation from RNA polymerase II promoter
Notch signaling pathway
cholesterol metabolic process
response to glucose
positive regulation of gene expression
negative regulation of gene expression
organ regeneration
positive regulation of insulin secretion
steroid hormone mediated signaling pathway
negative regulation of sequence-specific DNA binding transcription factor activity
sister chromatid cohesion
mitotic nuclear division
multicellular organism development
cell proliferation
cell division
cell-cell adhesion

Function(s)

DNA binding
steroid hormone receptor activity
transcription corepressor activity
protein binding
transcription factor binding
protein domain specific binding
protein complex binding
protein homodimerization activity
peroxisome proliferator activated receptor binding
retinoid X receptor binding
thyroid hormone receptor binding
cadherin binding involved in cell-cell adhesion