C_192143989_20

SNP ID:

rs201715670

Gene

GBA2 MSMP NPR2 RGP1

Gene Name

glucosylceramidase beta 2

microseminoprotein, prostate associated

natriuretic peptide receptor 2

RGP1 homolog, RAB6A GEF complex partner 1

Set Membership:

-

Chromosome Location:

Chr.9: 35749845 - 35749845 on Build GRCh38

Polymorphism:

T/C, Transition substitution

Context Sequence [VIC/FAM]:

GTGTAGTGACCGTCACCAACCCCCT[T/C]CCGCCCACGGCCACTTCTGCATCCA

Assay Details

Species:	Human
dbSNP Submissions:	NA
Phenotype:	MIM: 609471 MIM: 612191 MIM: 108961 MIM: 615742
Literature Links:	GBA2 PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global - Not Available	Caucasian - Not Available	CEPH (CEU) - Not Available
EAS - Not Available	African American - Not Available	YRI (Yoruba) - Not Available
SAS - Not Available	Chinese - Not Available	CHB (Han Chinese) - Not Available
AFR - Not Available	Japanese - Not Available	JPT (Japanese) - Not Available
EUR - Not Available
AMR - Not Available

GBA2 - glucosylceramidase beta 2
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_020944.2	238	Intron			NP_065995.1
XM_005251526.4	238	Intron			XP_005251583.1
XM_006716809.3	238	Intron			XP_006716872.1
XM_011517973.2	238	Intron			XP_011516275.1
XM_017014937.1	238	Intron			XP_016870426.1
XM_017014938.1	238	Intron			XP_016870427.1
XM_017014939.1	238	Intron			XP_016870428.1
XM_017014940.1	238	Intron			XP_016870429.1
XM_017014941.1	238	Intron			XP_016870430.1
XM_017014942.1	238	Intron			XP_016870431.1
XM_017014943.1	238	Intron			XP_016870432.1
XM_017014944.1	238	Intron			XP_016870433.1
XM_017014945.1	238	Intron			XP_016870434.1
XM_017014946.1	238	Intron			XP_016870435.1

MSMP - microseminoprotein, prostate associated
There are no transcripts associated with this gene.

NPR2 - natriuretic peptide receptor 2
There are no transcripts associated with this gene.

RGP1 - RGP1 homolog, RAB6A GEF complex partner 1
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_001080496.2	238	Silent Mutation	CTC,CTT	L,L 30	NP_001073965.2

More Information

Panther Classification:

Molecular Function -

glucosidase

Gene Ontology Categories:

Process(es)

glucosylceramide catabolic process
glycosphingolipid metabolic process
bile acid metabolic process
glycoside catabolic process
central nervous system neuron development
retrograde transport, endosome to Golgi
positive regulation of GTPase activity
negative regulation of cellular protein catabolic process

Function(s)

glucosylceramidase activity
beta-glucosidase activity
protein binding
Rab guanyl-nucleotide exchange factor activity
Rab GTPase binding