C_319361527_10

• SNP ID: rs566601261
• Gene: DLG2
• Gene Name: discs large MAGUK scaffold protein 2
• Set Membership: -
• Chromosome Location: Chr.11: 84044567 - 84044567 on Build GRCh38
• Polymorphism: T/C, Transition substitution
• Context Sequence [VIC/FAM]:

  GATCTCGGTAGAGGCTACAGGCAAG[T/C]GTGTCATTTTTCTTGTAAGACCCCA

Assay Details

Species:	Human
dbSNP Submissions:	NA
Phenotype:	MIM: 603583
Literature Links:	DLG2 PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global - Not Available	Caucasian - Not Available	CEPH (CEU) - Not Available
EAS - Not Available	African American - Not Available	YRI (Yoruba) - Not Available
SAS - Not Available	Chinese - Not Available	CHB (Han Chinese) - Not Available
AFR - Not Available	Japanese - Not Available	JPT (Japanese) - Not Available
EUR - Not Available
AMR - Not Available

DLG2 - discs large MAGUK scaffold protein 2
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_001142699.1		Intron			NP_001136171.1
NM_001142700.1		Intron			NP_001136172.1
NM_001142702.1		Intron			NP_001136174.1
NM_001206769.1		Intron			NP_001193698.1
NM_001300983.1		Intron			NP_001287912.1
NM_001364.3		Intron			NP_001355.2
XM_005273810.4		Intron			XP_005273867.1
XM_005273811.4		Intron			XP_005273868.1
XM_011544778.2		Intron			XP_011543080.1
XM_011544780.2		Intron			XP_011543082.1
XM_011544782.2		Intron			XP_011543084.1
XM_011544788.2		Intron			XP_011543090.1
XM_017017254.1		Intron			XP_016872743.1
XM_017017255.1		Intron			XP_016872744.1
XM_017017256.1		Intron			XP_016872745.1
XM_017017257.1		Intron			XP_016872746.1
XM_017017258.1		Intron			XP_016872747.1
XM_017017259.1		Intron			XP_016872748.1
XM_017017260.1		Intron			XP_016872749.1
XM_017017261.1		Intron			XP_016872750.1
XM_017017262.1		Intron			XP_016872751.1
XM_017017263.1		Intron			XP_016872752.1
XM_017017264.1		Intron			XP_016872753.1
XM_017017265.1		Intron			XP_016872754.1
XM_017017266.1		Intron			XP_016872755.1
XM_017017267.1		Intron			XP_016872756.1
XM_017017268.1		Intron			XP_016872757.1
XM_017017269.1		Intron			XP_016872758.1
XM_017017270.1		Intron			XP_016872759.1
XM_017017271.1		Intron			XP_016872760.1
XM_017017272.1		Intron			XP_016872761.1
XM_017017273.1		Intron			XP_016872762.1
XM_017017274.1		Intron			XP_016872763.1
XM_017017275.1		Intron			XP_016872764.1
XM_017017276.1		Intron			XP_016872765.1
XM_017017277.1		Intron			XP_016872766.1
XM_017017278.1		Intron			XP_016872767.1
XM_017017279.1		Intron			XP_016872768.1
XM_017017280.1		Intron			XP_016872769.1
XM_017017281.1		Intron			XP_016872770.1
XM_017017282.1		Intron			XP_016872771.1
XM_017017283.1		Intron			XP_016872772.1
XM_017017284.1		Intron			XP_016872773.1
XM_017017285.1		Intron			XP_016872774.1
XM_017017286.1		Intron			XP_016872775.1
XM_017017287.1		Intron			XP_016872776.1
XM_017017288.1		Intron			XP_016872777.1
XM_017017289.1		Intron			XP_016872778.1
XM_017017290.1		Intron			XP_016872779.1
XM_017017291.1		Intron			XP_016872780.1
XM_017017292.1		Intron			XP_016872781.1

More Information

Panther Classification:

Molecular Function -

scaffold/adaptor protein

Gene Ontology Categories:

Process(es)

chemical synaptic transmission
nervous system development
negative regulation of phosphatase activity
sensory perception of pain
receptor clustering
establishment or maintenance of epithelial cell apical/basal polarity
GMP metabolic process
GDP metabolic process
receptor localization to synapse

Function(s)

guanylate kinase activity
protein binding
kinase binding
ionotropic glutamate receptor binding