C_332254311_10

SNP ID:

rs754883586

Gene

GPHN PIGH PLEKHH1

Gene Name

gephyrin

phosphatidylinositol glycan anchor biosynthesis class H

pleckstrin homology, MyTH4 and FERM domain containing H1

Set Membership:

-

Chromosome Location:

Chr.14: 67596467 - 67596467 on Build GRCh38

Polymorphism:

G/A, Transition substitution

Context Sequence [VIC/FAM]:

AGCTATGATTTAGAAGACTGGCACA[G/A]GAAAAAAATTATTGATGACCTAGAA

Assay Details

Species:	Human
dbSNP Submissions:	NA
Phenotype:	MIM: 603930 MIM: 600154
Literature Links:	GPHN PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global - Not Available	Caucasian - Not Available	CEPH (CEU) - Not Available
EAS - Not Available	African American - Not Available	YRI (Yoruba) - Not Available
SAS - Not Available	Chinese - Not Available	CHB (Han Chinese) - Not Available
AFR - Not Available	Japanese - Not Available	JPT (Japanese) - Not Available
EUR - Not Available
AMR - Not Available

GPHN - gephyrin
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_001024218.1		Intron			NP_001019389.1
NM_020806.4		Intron			NP_065857.1
XM_005267254.3		Intron			XP_005267311.1
XM_011536340.2		Intron			XP_011534642.1
XM_011536342.2		Intron			XP_011534644.1
XM_011536343.2		Intron			XP_011534645.1
XM_011536344.2		Intron			XP_011534646.1
XM_011536345.2		Intron			XP_011534647.1
XM_011536346.2		Intron			XP_011534648.1
XM_011536347.2		Intron			XP_011534649.1
XM_017020913.1		Intron			XP_016876402.1
XM_017020914.1		Intron			XP_016876403.1
XM_017020915.1		Intron			XP_016876404.1
XM_017020916.1		Intron			XP_016876405.1
XM_017020917.1		Intron			XP_016876406.1
XM_017020918.1		Intron			XP_016876407.1
XM_017020919.1		Intron			XP_016876408.1
XM_017020920.1		Intron			XP_016876409.1
XM_017020921.1		Intron			XP_016876410.1
XM_017020922.1		Intron			XP_016876411.1
XM_017020923.1		Intron			XP_016876412.1
XM_017020924.1		Intron			XP_016876413.1
XM_017020925.1		Intron			XP_016876414.1
XM_017020926.1		Intron			XP_016876415.1

PIGH - phosphatidylinositol glycan anchor biosynthesis class H
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_004569.3		Intron			NP_004560.1
XM_011536838.2		Intron			XP_011535140.1
XM_017021371.1		Intron			XP_016876860.1
XM_017021372.1		Intron			XP_016876861.1

PLEKHH1 - pleckstrin homology, MyTH4 and FERM domain containing H1
There are no transcripts associated with this gene.

More Information

Panther Classification:

Molecular Function -

glycosyltransferase

Gene Ontology Categories:

Process(es)

Mo-molybdopterin cofactor biosynthetic process
molybdenum incorporation into molybdenum-molybdopterin complex
molybdopterin cofactor biosynthetic process
glycine receptor clustering
gamma-aminobutyric acid receptor clustering
cellular protein modification process
GPI anchor biosynthetic process
preassembly of GPI anchor in ER membrane

Function(s)

protein binding
ATP binding
metal ion binding
molybdopterin adenylyltransferase activity
molybdopterin molybdotransferase activity
catalytic activity
phosphatidylinositol N-acetylglucosaminyltransferase activity