C_362418365_10

SNP ID:

rs754366068

Gene

ATP5F1 C1orf162 WDR77

Gene Name

ATP synthase, H+ transporting, mitochondrial Fo complex subunit B1

chromosome 1 open reading frame 162

WD repeat domain 77

Set Membership:

-

Chromosome Location:

Chr.1: 111458602 - 111458602 on Build GRCh38

Polymorphism:

G/A, Transition substitution

Context Sequence [VIC/FAM]:

TAAAAGGAGATAGAGGGAGGCCTGG[G/A]ACTGTGATATATAAAGACCTTAGGC

Assay Details

Species:	Human
dbSNP Submissions:	4 submissions
Phenotype:	MIM: 603270 MIM: 611734
Literature Links:	ATP5F1 PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global - Not Available	Caucasian - Not Available	CEPH (CEU) - Not Available
EAS - Not Available	African American - Not Available	YRI (Yoruba) - Not Available
SAS - Not Available	Chinese - Not Available	CHB (Han Chinese) - Not Available
AFR - Not Available	Japanese - Not Available	JPT (Japanese) - Not Available
EUR - Not Available
AMR - Not Available

ATP5F1 - ATP synthase, H+ transporting, mitochondrial Fo complex subunit B1
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_001688.4		Intron			NP_001679.2

C1orf162 - chromosome 1 open reading frame 162
There are no transcripts associated with this gene.

WDR77 - WD repeat domain 77
There are no transcripts associated with this gene.

More Information

Panther Classification:

Molecular Function -

ATP synthase

Gene Ontology Categories:

Process(es)

ATP biosynthetic process
ATP synthesis coupled proton transport
substantia nigra development
mitochondrial ATP synthesis coupled proton transport

Function(s)

protein binding
ATPase activity
transmembrane transporter activity
proton-transporting ATP synthase activity, rotational mechanism