C_364119474_10

SNP ID:

rs776275758

Gene

FAAP20 LOC100506504 PRKCZ

Gene Name

Fanconi anemia core complex associated protein 20

uncharacterized LOC100506504

protein kinase C zeta

Set Membership:

-

Chromosome Location:

Chr.1: 2182473 - 2182473 on Build GRCh38

Polymorphism:

G/A, Transition substitution

Context Sequence [VIC/FAM]:

GCTGCCCCCCAGCTGGCGGGGCACC[G/A]GGGACAGGCACAGCCACACTGGGGG

Assay Details

Species:	Human
dbSNP Submissions:	5 submissions
Phenotype:	MIM: 615183 MIM: 176982
Literature Links:	FAAP20 PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global - Not Available	Caucasian - Not Available	CEPH (CEU) - Not Available
EAS - Not Available	African American - Not Available	YRI (Yoruba) - Not Available
SAS - Not Available	Chinese - Not Available	CHB (Han Chinese) - Not Available
AFR - Not Available	Japanese - Not Available	JPT (Japanese) - Not Available
EUR - Not Available
AMR - Not Available

FAAP20 - Fanconi anemia core complex associated protein 20
There are no transcripts associated with this gene.

LOC100506504 - uncharacterized LOC100506504
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
XM_011542503.2	875	Missense Mutation	CCG,CTG	P,L 83	XP_011540805.1

PRKCZ - protein kinase C zeta
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_001033581.1	875	Intron			NP_001028753.1
NM_001033582.1	875	Intron			NP_001028754.1
NM_001242874.1	875	Intron			NP_001229803.1
NM_002744.4	875	Intron			NP_002735.3
XM_011541773.1	875	Intron			XP_011540075.1
XM_011541774.1	875	Intron			XP_011540076.1
XM_011541775.2	875	Intron			XP_011540077.1
XM_011541776.1	875	Intron			XP_011540078.1
XM_011541778.1	875	Intron			XP_011540080.1
XM_017001789.1	875	Intron			XP_016857278.1
XM_017001790.1	875	Intron			XP_016857279.1
XM_017001791.1	875	Intron			XP_016857280.1
XM_017001792.1	875	Intron			XP_016857281.1
XM_017001793.1	875	Intron			XP_016857282.1
XM_017001794.1	875	Intron			XP_016857283.1
XM_017001795.1	875	Intron			XP_016857284.1
XM_017001796.1	875	Intron			XP_016857285.1
XM_017001797.1	875	Intron			XP_016857286.1
XM_017001798.1	875	Intron			XP_016857287.1
XM_017001799.1	875	Intron			XP_016857288.1
XM_017001800.1	875	Intron			XP_016857289.1
XM_017001801.1	875	Intron			XP_016857290.1
XM_017001802.1	875	Intron			XP_016857291.1
XM_017001803.1	875	Intron			XP_016857292.1
XM_017001804.1	875	Intron			XP_016857293.1
XM_017001805.1	875	Intron			XP_016857294.1

More Information

Panther Classification:

Molecular Function -

non-receptor serine/threonine protein kinase

Gene Ontology Categories:

Process(es)

microtubule cytoskeleton organization
positive regulation of cell-matrix adhesion
protein phosphorylation
inflammatory response
signal transduction
transforming growth factor beta receptor signaling pathway
long-term memory
positive regulation of cell proliferation
insulin receptor signaling pathway
cell migration
peptidyl-serine phosphorylation
establishment of cell polarity
negative regulation of protein complex assembly
actin cytoskeleton reorganization
activation of phospholipase D activity
activation of protein kinase B activity
positive regulation of interleukin-4 production
negative regulation of apoptotic process
positive regulation of T-helper 2 cell differentiation
positive regulation of glucose import
negative regulation of insulin receptor signaling pathway
positive regulation of insulin receptor signaling pathway
vesicle transport along microtubule
negative regulation of peptidyl-tyrosine phosphorylation
positive regulation of NF-kappaB transcription factor activity
protein heterooligomerization
negative regulation of hydrolase activity
membrane depolarization
membrane hyperpolarization
long-term synaptic potentiation
positive regulation of ERK1 and ERK2 cascade
protein kinase C signaling
protein localization to plasma membrane
neuron projection extension
positive regulation of excitatory postsynaptic potential
positive regulation of T-helper 2 cell cytokine production
positive regulation of interleukin-5 secretion
positive regulation of interleukin-13 secretion
positive regulation of interleukin-10 secretion

Function(s)

protein kinase activity
protein serine/threonine kinase activity
protein kinase C activity
protein binding
ATP binding
potassium channel regulator activity
protein kinase binding
protein domain specific binding
phospholipase binding
insulin receptor substrate binding
metal ion binding
14-3-3 protein binding