C_364579770_10

SNP ID:

rs780028612

Gene

RBBP4 SYNC

Gene Name

RB binding protein 4, chromatin remodeling factor

syncoilin, intermediate filament protein

Set Membership:

-

Chromosome Location:

Chr.1: 32683370 - 32683370 on Build GRCh38

Polymorphism:

T/A, Transversion substitution

Context Sequence [VIC/FAM]:

TTATATAAGGAACTTAATGGATAGA[T/A]ATGTTTATTATTTTTGATAGCACAA

Assay Details

Species:	Human
dbSNP Submissions:	4 submissions
Phenotype:	MIM: 602923 MIM: 611750
Literature Links:	RBBP4 PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global - Not Available	Caucasian - Not Available	CEPH (CEU) - Not Available
EAS - Not Available	African American - Not Available	YRI (Yoruba) - Not Available
SAS - Not Available	Chinese - Not Available	CHB (Han Chinese) - Not Available
AFR - Not Available	Japanese - Not Available	JPT (Japanese) - Not Available
EUR - Not Available
AMR - Not Available

RBBP4 - RB binding protein 4, chromatin remodeling factor
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_001135255.1	5002	UTR 3			NP_001128727.1
NM_001135256.1	5002	UTR 3			NP_001128728.1
NM_005610.2	5002	UTR 3			NP_005601.1

SYNC - syncoilin, intermediate filament protein
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_001161708.1	5002	Intron			NP_001155180.1
NM_030786.2	5002	Intron			NP_110413.2

More Information

Gene Ontology Categories:

Process(es)

DNA replication
DNA replication-dependent nucleosome assembly
DNA replication-independent nucleosome assembly
chromatin remodeling
transcription, DNA-templated
regulation of transcription, DNA-templated
cell cycle
negative regulation of cell proliferation
histone deacetylation
chromatin assembly
CENP-A containing nucleosome assembly
ATP-dependent chromatin remodeling
negative regulation of gene expression, epigenetic
regulation of cell cycle
regulation of signal transduction by p53 class mediator
intermediate filament-based process

Function(s)

RNA polymerase II core promoter proximal region sequence-specific DNA binding
RNA polymerase II distal enhancer sequence-specific DNA binding
histone deacetylase activity
protein binding
DNA-dependent ATPase activity
nucleosomal DNA binding
histone binding
histone deacetylase binding
structural molecule activity