C_386698654_10

SNP ID:

rs776718146

Gene

LRP2BP SNX25

Gene Name

LRP2 binding protein

sorting nexin 25

Set Membership:

-

Chromosome Location:

Chr.4: 185364202 - 185364202 on Build GRCh38

Polymorphism:

G/C, Transversion substitution

Context Sequence [VIC/FAM]:

TTGAAGTGAGGCATTAGGGAGGAGA[G/C]ATGGGAGCTGACCCTTGGAGTATGG

Assay Details

Species:	Human
dbSNP Submissions:	NA
Phenotype:
Literature Links:	LRP2BP PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global - Not Available	Caucasian - Not Available	CEPH (CEU) - Not Available
EAS - Not Available	African American - Not Available	YRI (Yoruba) - Not Available
SAS - Not Available	Chinese - Not Available	CHB (Han Chinese) - Not Available
AFR - Not Available	Japanese - Not Available	JPT (Japanese) - Not Available
EUR - Not Available
AMR - Not Available

LRP2BP - LRP2 binding protein
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_018409.3	5164	UTR 3			NP_060879.2
XM_005263125.4	5164	Intron			XP_005263182.1
XM_006714260.3	5164	UTR 3			XP_006714323.1
XM_006714265.3	5164	Intron			XP_006714328.1
XM_011532110.2	5164	Intron			XP_011530412.1
XM_011532111.2	5164	Intron			XP_011530413.1
XM_017008410.1	5164	UTR 3			XP_016863899.1
XM_017008411.1	5164	Intron			XP_016863900.1

SNX25 - sorting nexin 25
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_001317781.1	5164	Intron			NP_001304710.1
XM_005263267.4	5164	Intron			XP_005263324.1
XM_011532302.2	5164	Intron			XP_011530604.1
XM_011532303.2	5164	Intron			XP_011530605.1
XM_011532304.2	5164	Intron			XP_011530606.1
XM_011532305.2	5164	Intron			XP_011530607.1
XM_011532306.2	5164	Intron			XP_011530608.1
XM_011532307.2	5164	Intron			XP_011530609.1
XM_011532308.2	5164	Intron			XP_011530610.1
XM_017008680.1	5164	Intron			XP_016864169.1
XM_017008681.1	5164	Intron			XP_016864170.1
XM_017008682.1	5164	Intron			XP_016864171.1
XM_017008683.1	5164	Intron			XP_016864172.1
XM_017008684.1	5164	Intron			XP_016864173.1
XM_017008685.1	5164	Intron			XP_016864174.1
XM_017008686.1	5164	Intron			XP_016864175.1
XM_017008687.1	5164	Intron			XP_016864176.1

More Information

Panther Classification:

Molecular Function -

scaffold/adaptor protein

Gene Ontology Categories:

Process(es)

protein transport
negative regulation of transforming growth factor beta receptor signaling pathway
receptor catabolic process
negative regulation of pathway-restricted SMAD protein phosphorylation

Function(s)

protein binding
molecular_function
type I transforming growth factor beta receptor binding
phosphatidylinositol binding