C_391621940_10

• SNP ID: rs751807762
• Gene: PDE4D
• Gene Name: phosphodiesterase 4D
• Set Membership: -
• Chromosome Location: Chr.5: 59855373 - 59855373 on Build GRCh38
• Polymorphism: A/G, Transition substitution
• Context Sequence [VIC/FAM]:

  ATTTACAAAGATACACGTAATAACA[A/G]ATATTTAAGAAATCTGAAAGTCAAA

Assay Details

Species:	Human
dbSNP Submissions:	NA
Phenotype:	MIM: 600129
Literature Links:	PDE4D PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global - Not Available	Caucasian - Not Available	CEPH (CEU) - Not Available
EAS - Not Available	African American - Not Available	YRI (Yoruba) - Not Available
SAS - Not Available	Chinese - Not Available	CHB (Han Chinese) - Not Available
AFR - Not Available	Japanese - Not Available	JPT (Japanese) - Not Available
EUR - Not Available
AMR - Not Available

PDE4D - phosphodiesterase 4D
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_001104631.1		Intron			NP_001098101.1
NM_001165899.1		Intron			NP_001159371.1
NM_001197218.1		Intron			NP_001184147.1
NM_001197219.1		Intron			NP_001184148.1
NM_001197220.1		Intron			NP_001184149.1
NM_001197221.1		Intron			NP_001184150.1
NM_001197222.1		Intron			NP_001184151.1
NM_001197223.1		Intron			NP_001184152.1
NM_006203.4		Intron			NP_006194.2
XM_005248537.3		Intron			XP_005248594.1
XM_005248538.4		Intron			XP_005248595.1
XM_011543469.1		Intron			XP_011541771.1
XM_011543470.2		Intron			XP_011541772.1
XM_011543471.1		Intron			XP_011541773.1
XM_011543473.1		Intron			XP_011541775.1
XM_011543477.2		Intron			XP_011541779.1
XM_017009565.1		Intron			XP_016865054.1
XM_017009566.1		Intron			XP_016865055.1
XM_017009567.1		Intron			XP_016865056.1
XM_017009568.1		Intron			XP_016865057.1
XM_017009569.1		Intron			XP_016865058.1
XM_017009570.1		Intron			XP_016865059.1
XM_017009571.1		Intron			XP_016865060.1

More Information

Panther Classification:

Molecular Function -

phosphodiesterase

Gene Ontology Categories:

Process(es)

regulation of heart rate
cAMP catabolic process
smooth muscle contraction
aging
regulation of receptor activity
regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum
cAMP-mediated signaling
neutrophil chemotaxis
regulation of cAMP metabolic process
positive regulation of interferon-gamma production
positive regulation of interleukin-2 production
positive regulation of interleukin-5 production
negative regulation of peptidyl-serine phosphorylation
multicellular organism growth
negative regulation of heart contraction
T cell receptor signaling pathway
regulation of ryanodine-sensitive calcium-release channel activity
establishment of endothelial barrier
cellular response to lipopolysaccharide
cellular response to epinephrine stimulus
adrenergic receptor signaling pathway
regulation of cardiac muscle cell contraction
adrenergic receptor signaling pathway involved in positive regulation of heart rate
regulation of cell communication by electrical coupling involved in cardiac conduction
negative regulation of relaxation of cardiac muscle

Function(s)

3',5'-cyclic-nucleotide phosphodiesterase activity
3',5'-cyclic-AMP phosphodiesterase activity
protein binding
drug binding
enzyme binding
cAMP binding
beta-2 adrenergic receptor binding
ion channel binding
metal ion binding
ATPase binding
scaffold protein binding