C_397809036_10

• SNP ID: rs755810349
• Gene: PARK2
• Gene Name: parkin RBR E3 ubiquitin protein ligase
• Set Membership: -
• Chromosome Location: Chr.6: 162413366 - 162413366 on Build GRCh38
• Polymorphism: C/T, Transition substitution
• Context Sequence [VIC/FAM]:

  TATGAGGGAGCGGTCTACATATTTG[C/T]GTTGTGTAGCTATGCAGGGGGAAAG

Assay Details

Species:	Human
dbSNP Submissions:	NA
Phenotype:	MIM: 602544
Literature Links:	PARK2 PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global - Not Available	Caucasian - Not Available	CEPH (CEU) - Not Available
EAS - Not Available	African American - Not Available	YRI (Yoruba) - Not Available
SAS - Not Available	Chinese - Not Available	CHB (Han Chinese) - Not Available
AFR - Not Available	Japanese - Not Available	JPT (Japanese) - Not Available
EUR - Not Available
AMR - Not Available

PARK2 - parkin RBR E3 ubiquitin protein ligase
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_004562.2		Intron			NP_004553.2
NM_013987.2		Intron			NP_054642.2
NM_013988.2		Intron			NP_054643.2
XM_011535863.1		Intron			XP_011534165.1
XM_017010908.1		Intron			XP_016866397.1
XM_017010909.1		Intron			XP_016866398.1

More Information

Gene Ontology Categories:

Process(es)

negative regulation of transcription from RNA polymerase II promoter
protein polyubiquitination
mitochondrial fission
mitophagy
negative regulation of protein phosphorylation
startle response
transcription, DNA-templated
protein monoubiquitination
response to oxidative stress
mitochondrion organization
central nervous system development
learning
adult locomotory behavior
proteasomal protein catabolic process
regulation of autophagy
positive regulation of gene expression
negative regulation of gene expression
positive regulation of mitochondrial fusion
negative regulation of mitochondrial fusion
regulation of mitochondrion organization
regulation of glucose metabolic process
free ubiquitin chain polymerization
regulation of dopamine secretion
macroautophagy
protein ubiquitination
regulation of protein ubiquitination
protein destabilization
negative regulation of actin filament bundle assembly
regulation of lipid transport
positive regulation of proteasomal ubiquitin-dependent protein catabolic process
negative regulation of glucokinase activity
cellular response to unfolded protein
response to endoplasmic reticulum stress
synaptic transmission, glutamatergic
protein K29-linked ubiquitination
ERAD pathway
regulation of dopamine metabolic process
norepinephrine metabolic process
dopamine metabolic process
protein ubiquitination involved in ubiquitin-dependent protein catabolic process
positive regulation of I-kappaB kinase/NF-kappaB signaling
proteasome-mediated ubiquitin-dependent protein catabolic process
positive regulation of DNA binding
negative regulation of neuron apoptotic process
cellular protein catabolic process
cellular protein metabolic process
protein K27-linked ubiquitination
negative regulation by host of viral genome replication
positive regulation of protein catabolic process
positive regulation of transcription from RNA polymerase II promoter
negative regulation of JNK cascade
negative regulation of insulin secretion
protein stabilization
positive regulation of neurotransmitter uptake
dopamine uptake involved in synaptic transmission
protein autoubiquitination
regulation of mitochondrial membrane potential
zinc ion homeostasis
negative regulation of cell death
regulation of canonical Wnt signaling pathway
parkin-mediated mitophagy in response to mitochondrial depolarization
neuron cellular homeostasis
protein K63-linked ubiquitination
protein localization to mitochondrion
aggresome assembly
protein K48-linked ubiquitination
protein K11-linked ubiquitination
cellular response to manganese ion
protein K6-linked ubiquitination
negative regulation of canonical Wnt signaling pathway
positive regulation of mitochondrial fission
negative regulation of release of cytochrome c from mitochondria
cellular response to toxic substance
mitophagy in response to mitochondrial depolarization
regulation of cellular response to oxidative stress
negative regulation of neuron death
positive regulation of proteasomal protein catabolic process
negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway
negative regulation of intrinsic apoptotic signaling pathway by p53 class mediator
negative regulation of primary amine oxidase activity
positive regulation of protein linear polyubiquitination
regulation of synaptic vesicle transport
negative regulation of oxidative stress-induced cell death
regulation of protein targeting to mitochondrion
positive regulation of tumor necrosis factor-mediated signaling pathway
cellular response to dopamine
negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway
positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway
negative regulation of endoplasmic reticulum stress-induced neuron intrinsic apoptotic signaling pathway
positive regulation of dendrite extension
negative regulation of spontaneous neurotransmitter secretion
regulation of reactive oxygen species metabolic process
negative regulation of reactive oxygen species metabolic process

Function(s)

transcription regulatory region sequence-specific DNA binding
G-protein coupled receptor binding
transcription factor activity, sequence-specific DNA binding
actin binding
ubiquitin-protein transferase activity
protein binding
beta-catenin binding
zinc ion binding
tubulin binding
ligase activity
SH3 domain binding
enzyme binding
kinase binding
protein kinase binding
PDZ domain binding
Hsp70 protein binding
heat shock protein binding
ubiquitin conjugating enzyme binding
ubiquitin protein ligase binding
identical protein binding
histone deacetylase binding
ubiquitin binding
phospholipase binding
chaperone binding
ubiquitin protein ligase activity
cullin family protein binding
ubiquitin protein ligase activity involved in ERAD pathway
ubiquitin-specific protease binding
F-box domain binding