C__26823981_10

SNP ID:

rs11673270

Gene

CYP2A7P1 CYP2B6

Gene Name

cytochrome P450 family 2 subfamily A member 7 pseudogene 1

cytochrome P450 family 2 subfamily B member 6

Set Membership:

> HapMap

Chromosome Location:

Chr.19: 41014939 - 41014939 on Build GRCh38

Polymorphism:

A/C, Transversion substitution

Context Sequence [VIC/FAM]:

AGGAAAAAGAGAGAGTGACATAAAA[A/C]GAGAGGAAGAAAGAATGAACAAGAC

Assay Details

Species:	Human
dbSNP Submissions:	NA
Phenotype:	MIM: 123930
Literature Links:	CYP2A7P1 PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global C (0.35) (0.65)	Caucasian - Not Available	CEPH (CEU) C (0.28) (0.72)
EAS C (0.22) (0.78)	African American - Not Available	YRI (Yoruba) A (0.47) (0.53)
SAS C (0.38) (0.62)	Chinese - Not Available	JPT (Japanese) C (0.18) (0.82)
AFR C (0.49) (0.51)	Japanese - Not Available	CHB (Han Chinese) C (0.15) (0.85)
EUR C (0.24) (0.76)
AMR C (0.39) (0.61)

CYP2A7P1 - cytochrome P450 family 2 subfamily A member 7 pseudogene 1
There are no transcripts associated with this gene.

CYP2B6 - cytochrome P450 family 2 subfamily B member 6
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_000767.4		Intron			NP_000758.1
XM_005258569.4		Intron			XP_005258626.1
XM_006723050.3		Intron			XP_006723113.1
XM_011526546.2		Intron			XP_011524848.1
XM_011526547.2		Intron			XP_011524849.1
XM_011526548.2		Intron			XP_011524850.1
XM_011526549.2		Intron			XP_011524851.1
XM_011526550.2		Intron			XP_011524852.1

More Information

• Set Membership: HapMap

Panther Classification:

Molecular Function -

oxidoreductase, oxygenase, metabolite interconversion enzyme

Gene Ontology Categories:

Process(es)

xenobiotic metabolic process
steroid metabolic process
drug metabolic process
epoxygenase P450 pathway
cellular ketone metabolic process
exogenous drug catabolic process
oxidation-reduction process

Function(s)

monooxygenase activity
iron ion binding
arachidonic acid epoxygenase activity
steroid hydroxylase activity
oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen
oxygen binding
heme binding