C__27066715_10

• SNP ID: rs4477358
• Gene: PCDH15
• Gene Name: protocadherin related 15
• Set Membership: > HapMap
• Chromosome Location: Chr.10: 54182261 - 54182261 on Build GRCh38
• Polymorphism: C/T, Transition substitution
• Context Sequence [VIC/FAM]:

  GGATTACAGGTGTGAGCCGCCATGC[C/T]CAGCTGCATTGAATGATTTCTAATT

Assay Details

Species:	Human
dbSNP Submissions:	NA
Phenotype:	MIM: 605514
Literature Links:	PCDH15 PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global T (0.37) (0.63)	Caucasian - Not Available	CEPH (CEU) T (0.04) (0.96)
EAS T (0.06) (0.94)	African American - Not Available	YRI (Yoruba) - Not Available
SAS T (0.26) (0.74)	Chinese - Not Available	CHB (Han Chinese) - Not Available
AFR C (0.32) (0.68)	Japanese - Not Available	JPT (Japanese) - Not Available
EUR T (0.41) (0.59)
AMR T (0.30) (0.70)

PCDH15 - protocadherin related 15
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_001142763.1		Intron			NP_001136235.1
NM_001142764.1		Intron			NP_001136236.1
NM_001142765.1		Intron			NP_001136237.1
NM_001142766.1		Intron			NP_001136238.1
NM_001142767.1		Intron			NP_001136239.1
NM_001142768.1		Intron			NP_001136240.1
NM_001142769.1		Intron			NP_001136241.1
NM_001142770.1		Intron			NP_001136242.1
NM_001142771.1		Intron			NP_001136243.1
NM_001142772.1		Intron			NP_001136244.1
NM_001142773.1		Intron			NP_001136245.1
NM_033056.3		Intron			NP_149045.3
XM_017016571.1		Intron			XP_016872060.1
XM_017016572.1		Intron			XP_016872061.1
XM_017016573.1		Intron			XP_016872062.1

More Information

• Set Membership: HapMap

Panther Classification:

Molecular Function -

cadherin

Gene Ontology Categories:

Process(es)

homophilic cell adhesion via plasma membrane adhesion molecules
sensory perception of sound
photoreceptor cell maintenance
inner ear development
sensory perception of light stimulus
equilibrioception

Function(s)

calcium ion binding