C__27855506_20

• SNP ID: rs9438945
• Gene: RIMS3
• Gene Name: regulating synaptic membrane exocytosis 3
• Set Membership: > HapMap
• Chromosome Location: Chr.1: 40673912 - 40673912 on Build GRCh38
• Polymorphism: C/G, Transversion substitution
• Context Sequence [VIC/FAM]:

  GCTGGCATCACAGGGGAGTTGTAAA[C/G]ATTAAATGAGAAAACATATGTAAAG

Assay Details

Species:	Human
dbSNP Submissions:	33 submissions
Phenotype:	MIM: 611600
Literature Links:	RIMS3 PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global C (0.08) (0.92)	Caucasian - Not Available	CEPH (CEU) C (0.13) (0.87)
EAS C (0.01) (0.99)	African American - Not Available	YRI (Yoruba) C (0.16) (0.84)
SAS C (0.07) (0.93)	Chinese - Not Available	JPT (Japanese) C (0.01) (0.99)
AFR C (0.14) (0.86)	Japanese - Not Available	CHB (Han Chinese) C (0.01) (0.99)
EUR C (0.11) (0.89)
AMR C (0.07) (0.93)

RIMS3 - regulating synaptic membrane exocytosis 3
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_014747.2		Intron			NP_055562.2
XM_011542479.2		Intron			XP_011540781.1

More Information

• Set Membership: HapMap

Panther Classification:

Molecular Function -

membrane traffic protein

Gene Ontology Categories:

Process(es)

neurotransmitter transport
calcium ion regulated exocytosis
regulation of membrane potential
mitophagy in response to mitochondrial depolarization
regulation of synaptic vesicle exocytosis

Function(s)

ion channel binding