C__29676879_10

• SNP ID: rs9597918
• Gene: STARD13
• Gene Name: StAR related lipid transfer domain containing 13
• Set Membership: > HapMap
• Chromosome Location: Chr.13: 33664106 - 33664106 on Build GRCh38
• Polymorphism: A/C, Transversion substitution
• Context Sequence [VIC/FAM]:

  AACAGGATTTTCCTAGATCCAAGTA[A/C]CCACGAATCCTTTCCAGTTGCCACT

Assay Details

Species:	Human
dbSNP Submissions:	NA
Phenotype:	MIM: 609866
Literature Links:	STARD13 PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global C (0.07) (0.93)	Caucasian - Not Available	CEPH (CEU) C (0.03) (0.97)
EAS C (0.00) (1.00)	African American - Not Available	YRI (Yoruba) C (0.23) (0.77)
SAS C (0.01) (0.99)	Chinese - Not Available	CHB (Han Chinese) - Not Available
AFR C (0.24) (0.76)	Japanese - Not Available	JPT (Japanese) - Not Available
EUR C (0.02) (0.98)
AMR C (0.03) (0.97)

STARD13 - StAR related lipid transfer domain containing 13
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_001243466.1	190	Intron			NP_001230395.1
NM_001243474.1	190	Intron			NP_001230403.1
NM_001243476.2	190	UTR 5			NP_001230405.1
NM_052851.2	190	Intron			NP_443083.1
NM_178006.3	190	Intron			NP_821074.1
NM_178007.2	190	Intron			NP_821075.1
XM_011535299.2	190	Intron			XP_011533601.1
XM_017020834.1	190	Intron			XP_016876323.1
XM_017020835.1	190	Intron			XP_016876324.1

More Information

• Set Membership: HapMap

Panther Classification:

Molecular Function -

G-protein modulator, protein-binding activity modulator, GTPase-activating protein

Gene Ontology Categories:

Process(es)

signal transduction
endothelial cell migration
positive regulation of GTPase activity
regulation of small GTPase mediated signal transduction
negative regulation of cell migration involved in sprouting angiogenesis
endothelial tube lumen extension

Function(s)

GTPase activator activity
protein binding
lipid binding