C__30309981_10

SNP ID:

rs9828491

Gene

LOC105377135 SFMBT1

Gene Name

transcription initiation factor TFIID subunit 4-like

Scm-like with four mbt domains 1

Set Membership:

-

Chromosome Location:

Chr.3: 52999065 - 52999065 on Build GRCh38

Polymorphism:

C/G, Transversion substitution

Context Sequence [VIC/FAM]:

CATCCATGCGTAAGCCGGGGACGCC[C/G]GAGGACATGCTCTTCACCCAAGGCC

Assay Details

Species:	Human
dbSNP Submissions:	NA
Phenotype:	MIM: 607319
Literature Links:	LOC105377135 PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global G (0.30) (0.70)	Caucasian - Not Available	CEPH (CEU) - Not Available
EAS - Not Available	African American - Not Available	YRI (Yoruba) - Not Available
SAS - Not Available	Chinese - Not Available	CHB (Han Chinese) - Not Available
AFR - Not Available	Japanese - Not Available	JPT (Japanese) - Not Available
EUR - Not Available
AMR - Not Available

LOC105377135 - transcription initiation factor TFIID subunit 4-like
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
XM_011534353.2	21	Silent Mutation	CCC,CCG	P,P 7	XP_011532655.1

SFMBT1 - Scm-like with four mbt domains 1
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_016329.3	21	Intron			NP_057413.2
XM_005265221.3	21	Intron			XP_005265278.1
XM_006713203.3	21	Intron			XP_006713266.1
XM_006713204.3	21	Intron			XP_006713267.1
XM_011533824.2	21	Intron			XP_011532126.1
XM_011533825.2	21	Intron			XP_011532127.1

More Information

Panther Classification:

Molecular Function -

chromatin/chromatin-binding, or -regulatory protein

Gene Ontology Categories:

Process(es)

transcription, DNA-templated
spermatogenesis
covalent chromatin modification
cell differentiation
negative regulation of transcription, DNA-templated
negative regulation of muscle organ development

Function(s)

transcription corepressor activity
protein binding
histone binding