C__61226563_10

SNP ID:

rs28503996

Gene

CYP2D6 CYP2D7 LOC102723722 NDUFA6-AS1

Gene Name

cytochrome P450 family 2 subfamily D member 6

cytochrome P450 family 2 subfamily D member 7 (gene/pseudogene)

uncharacterized LOC102723722

NDUFA6 antisense RNA 1 (head to head)

Set Membership:

-

Chromosome Location:

Chr.22: 42134849 - 42134849 on Build GRCh38

Polymorphism:

A/C, Transversion substitution

Context Sequence [VIC/FAM]:

AGGGCTCAGGGCCTTGCCGGCCTTC[A/C]TGAATATGGGCACAGCTGCAGACAG

Assay Details

Species:	Human
dbSNP Submissions:	NA
Phenotype:	MIM: 124030
Literature Links:	CYP2D6 PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global - Not Available	Caucasian - Not Available	CEPH (CEU) - Not Available
EAS - Not Available	African American - Not Available	YRI (Yoruba) - Not Available
SAS - Not Available	Chinese - Not Available	CHB (Han Chinese) - Not Available
AFR - Not Available	Japanese - Not Available	JPT (Japanese) - Not Available
EUR - Not Available
AMR - Not Available

CYP2D6 - cytochrome P450 family 2 subfamily D member 6
There are no transcripts associated with this gene.

CYP2D7 - cytochrome P450 family 2 subfamily D member 7 (gene/pseudogene)
There are no transcripts associated with this gene.

LOC102723722 - uncharacterized LOC102723722
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
XM_017029174.1		Intron			XP_016884663.1

NDUFA6-AS1 - NDUFA6 antisense RNA 1 (head to head)
There are no transcripts associated with this gene.