C___2133868_10

• SNP ID: rs8005905
• Gene: HSP90AA1
• Gene Name: heat shock protein 90 alpha family class A member 1
• Set Membership: > HapMap > Validated
• Chromosome Location: Chr.14: 102102030 - 102102030 on Build GRCh38
• Polymorphism: A/T, Transversion substitution
• Context Sequence [VIC/FAM]:

  AGTAGAGTGGTGGATCCAGACACCA[A/T]CAGATGCCAGAGAAACACTTGGGCC

Assay Details

Species:	Human
dbSNP Submissions:	NA
Phenotype:	MIM: 140571
Literature Links:	HSP90AA1 PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global T (0.20) (0.80)	Caucasian T (0.10) (0.90)	CEPH (CEU) T (0.08) (0.92)
EAS T (0.18) (0.82)	African American T (0.34) (0.66)	YRI (Yoruba) A (0.48) (0.52)
SAS T (0.12) (0.88)	Chinese - Not Available	JPT (Japanese) A (0.20) (0.80)
AFR T (0.41) (0.59)	Japanese - Not Available	CHB (Han Chinese) T (0.14) (0.86)
EUR A (0.10) (0.90)
AMR T (0.08) (0.92)

HSP90AA1 - heat shock protein 90 alpha family class A member 1
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_001017963.2	556	Missense Mutation	ATG,TTG	M,L 71	NP_001017963.2
NM_005348.3	556	Intron			NP_005339.3
XM_011536718.2	556	Missense Mutation	ATG,TTG	M,L 70	XP_011535020.1

More Information

• Set Membership: HapMap, Validated

Panther Classification:

Molecular Function -

Hsp90 family chaperone

Gene Ontology Categories:

Process(es)

G2/M transition of mitotic cell cycle
neuron migration
skeletal muscle contraction
mitochondrial transport
receptor-mediated endocytosis
response to unfolded protein
signal transduction
response to heat
response to cold
response to salt stress
positive regulation of lamellipodium assembly
cardiac muscle cell apoptotic process
peptidyl-tyrosine phosphorylation
regulation of protein ubiquitination
positive regulation of protein import into nucleus, translocation
Fc-gamma receptor signaling pathway involved in phagocytosis
ERBB2 signaling pathway
protein refolding
regulation of protein complex assembly
protein unfolding
response to estrogen
protein import into mitochondrial outer membrane
positive regulation of nitric oxide biosynthetic process
positive regulation of cell size
response to antibiotic
vascular endothelial growth factor receptor signaling pathway
protein stabilization
regulation of nitric-oxide synthase activity
chaperone-mediated protein complex assembly
positive regulation of cardiac muscle contraction
chaperone-mediated autophagy
regulation of cellular response to heat

Function(s)

nucleotide binding
UTP binding
CTP binding
mRNA binding
protein tyrosine kinase activity
protein binding
ATP binding
GTP binding
ATPase activity
sulfonylurea receptor binding
protein kinase binding
protein phosphatase binding
MHC class II protein complex binding
nitric-oxide synthase regulator activity
TPR domain binding
dATP binding
identical protein binding
protein homodimerization activity
histone deacetylase binding
ion channel binding
poly(A) RNA binding
GTPase binding
Rho GDP-dissociation inhibitor binding
unfolded protein binding