C___3018742_20

SNP ID:

rs9869557

Gene

PEX5L USP13

Gene Name

peroxisomal biogenesis factor 5 like

ubiquitin specific peptidase 13 (isopeptidase T-3)

Set Membership:

-

Chromosome Location:

Chr.3: 179796598 - 179796598 on Build GRCh38

Polymorphism:

C/T, Transition substitution

Context Sequence [VIC/FAM]:

TTATGTGTAGAATTCTGTCTTTGAG[C/T]TCATGGTATGTGTGTGAGGGTACCG

Assay Details

Species:	Human
dbSNP Submissions:	NA
Phenotype:	MIM: 611058 MIM: 603591
Literature Links:	PEX5L PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global T (0.14) (0.86)	Caucasian - Not Available	CEPH (CEU) - Not Available
EAS - Not Available	African American - Not Available	YRI (Yoruba) - Not Available
SAS - Not Available	Chinese - Not Available	CHB (Han Chinese) - Not Available
AFR - Not Available	Japanese - Not Available	JPT (Japanese) - Not Available
EUR - Not Available
AMR - Not Available

PEX5L - peroxisomal biogenesis factor 5 like
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_001256750.1	8759	UTR 3			NP_001243679.1
NM_001256751.1	8759	UTR 3			NP_001243680.1
NM_001256752.1	8759	UTR 3			NP_001243681.1
NM_001256753.1	8759	UTR 3			NP_001243682.1
NM_001256754.1	8759	UTR 3			NP_001243683.1
NM_001256755.1	8759	UTR 3			NP_001243684.1
NM_001256756.1	8759	UTR 3			NP_001243685.1
NM_016559.2	8759	UTR 3			NP_057643.1
XM_011512882.2	8759	UTR 3			XP_011511184.1
XM_011512884.2	8759	UTR 3			XP_011511186.1
XM_011512885.2	8759	UTR 3			XP_011511187.1
XM_011512886.2	8759	UTR 3			XP_011511188.1
XM_011512887.2	8759	UTR 3			XP_011511189.1
XM_011512888.2	8759	UTR 3			XP_011511190.1
XM_011512891.2	8759	UTR 3			XP_011511193.1
XM_011512892.2	8759	UTR 3			XP_011511194.1
XM_017006601.1	8759	UTR 3			XP_016862090.1
XM_017006602.1	8759	UTR 3			XP_016862091.1
XM_017006603.1	8759	UTR 3			XP_016862092.1
XM_017006604.1	8759	UTR 3			XP_016862093.1
XM_017006605.1	8759	UTR 3			XP_016862094.1
XM_017006606.1	8759	UTR 3			XP_016862095.1
XM_017006607.1	8759	UTR 3			XP_016862096.1
XM_017006608.1	8759	UTR 3			XP_016862097.1
XM_017006609.1	8759	UTR 3			XP_016862098.1
XM_017006610.1	8759	UTR 3			XP_016862099.1
XM_017006611.1	8759	UTR 3			XP_016862100.1

USP13 - ubiquitin specific peptidase 13 (isopeptidase T-3)
There are no transcripts associated with this gene.

More Information

Panther Classification:

Molecular Function -

membrane trafficking regulatory protein

Gene Ontology Categories:

Process(es)

protein import into peroxisome matrix, docking
regulation of cAMP-mediated signaling

Function(s)

peroxisome targeting sequence binding
small GTPase binding