C___8952941_20

• SNP ID: rs980693
• Gene: NPAS3
• Gene Name: neuronal PAS domain protein 3
• Set Membership: -
• Chromosome Location: Chr.14: 33535189 - 33535189 on Build GRCh38
• Polymorphism: T/C, Transition substitution
• Context Sequence [VIC/FAM]:

  TATATACTGTCATAAAAAATATCAC[T/C]TACACCTTTACTAAAAGAAATCTGG

Assay Details

Species:	Human
dbSNP Submissions:	NA
Phenotype:	MIM: 609430
Literature Links:	NPAS3 PubMed Links
Allele Nomenclature:
Minor Allele Frequency:

1000Genome	Applied Biosystems^®	HapMap
Global C (0.13) (0.87)	Caucasian - Not Available	CEPH (CEU) - Not Available
EAS C (0.05) (0.95)	African American - Not Available	YRI (Yoruba) - Not Available
SAS C (0.07) (0.93)	Chinese - Not Available	CHB (Han Chinese) - Not Available
AFR C (0.24) (0.76)	Japanese - Not Available	JPT (Japanese) - Not Available
EUR C (0.12) (0.88)
AMR C (0.12) (0.88)

NPAS3 - neuronal PAS domain protein 3
Transcript Accession	SNP Location	SNP Type	Observed Codons	Observed Amino Acid	Protein ID
NM_001164749.1		Intron			NP_001158221.1
NM_001165893.1		Intron			NP_001159365.1
NM_022123.2		Intron			NP_071406.1
NM_173159.2		Intron			NP_775182.1
XM_005267991.3		Intron			XP_005268048.2
XM_005267992.3		Intron			XP_005268049.2
XM_011537067.2		Intron			XP_011535369.1
XM_011537069.2		Intron			XP_011535371.2
XM_011537070.2		Intron			XP_011535372.1
XM_011537071.2		Intron			XP_011535373.2
XM_011537072.2		Intron			XP_011535374.1
XM_017021582.1		Intron			XP_016877071.1
XM_017021583.1		Intron			XP_016877072.1
XM_017021584.1		Intron			XP_016877073.1
XM_017021585.1		Intron			XP_016877074.1
XM_017021586.1		Intron			XP_016877075.1
XM_017021587.1		Intron			XP_016877076.1
XM_017021588.1		Intron			XP_016877077.1

More Information

Panther Classification:

Molecular Function -

basic helix-loop-helix transcription factor

Gene Ontology Categories:

Process(es)

transcription, DNA-templated
regulation of transcription from RNA polymerase II promoter
developmental process
positive regulation of transcription, DNA-templated

Function(s)

RNA polymerase II transcription factor activity, sequence-specific DNA binding
DNA binding
protein dimerization activity